Incidental Mutation 'R6072:Dopey1'
ID482543
Institutional Source Beutler Lab
Gene Symbol Dopey1
Ensembl Gene ENSMUSG00000034973
Gene Namedopey family member 1
SynonymsB130005I07Rik, D9Ertd809e
Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location86467154-86555923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86507697 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 558 (S558N)
Ref Sequence ENSEMBL: ENSMUSP00000140040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]
Predicted Effect probably benign
Transcript: ENSMUST00000034987
AA Change: S560N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: S560N

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185840
Predicted Effect probably benign
Transcript: ENSMUST00000185919
AA Change: S558N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: S558N

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187607
Predicted Effect probably benign
Transcript: ENSMUST00000188675
AA Change: S550N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973
AA Change: S550N

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 3e-106 PFAM
low complexity region 622 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190906
Predicted Effect probably benign
Transcript: ENSMUST00000190957
AA Change: S560N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: S560N

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Dopey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dopey1 APN 9 86551679 missense possibly damaging 0.57
IGL00427:Dopey1 APN 9 86521500 missense probably benign 0.09
IGL00427:Dopey1 APN 9 86521498 missense possibly damaging 0.93
IGL00427:Dopey1 APN 9 86521499 missense probably damaging 0.96
IGL00577:Dopey1 APN 9 86520946 missense probably damaging 1.00
IGL00741:Dopey1 APN 9 86522806 missense possibly damaging 0.50
IGL00959:Dopey1 APN 9 86487431 missense probably damaging 1.00
IGL01339:Dopey1 APN 9 86551677 missense possibly damaging 0.90
IGL01608:Dopey1 APN 9 86507561 missense probably benign 0.23
IGL01760:Dopey1 APN 9 86519923 missense probably benign
IGL01788:Dopey1 APN 9 86531719 missense probably benign 0.03
IGL01844:Dopey1 APN 9 86514085 missense probably damaging 1.00
IGL01923:Dopey1 APN 9 86522867 missense probably damaging 1.00
IGL02036:Dopey1 APN 9 86531765 missense probably benign 0.18
IGL02308:Dopey1 APN 9 86520088 missense probably damaging 0.98
IGL02494:Dopey1 APN 9 86526818 missense probably damaging 1.00
IGL02698:Dopey1 APN 9 86524359 splice site probably benign
IGL02731:Dopey1 APN 9 86487381 missense probably damaging 1.00
IGL02821:Dopey1 APN 9 86520156 missense probably benign
IGL02952:Dopey1 APN 9 86532922 splice site probably benign
IGL03071:Dopey1 APN 9 86489615 missense possibly damaging 0.91
IGL03271:Dopey1 APN 9 86504222 nonsense probably null
IGL03344:Dopey1 APN 9 86536144 missense probably damaging 1.00
beg UTSW 9 86548172 nonsense probably null
groak UTSW 9 86521657 missense probably damaging 1.00
R0055:Dopey1 UTSW 9 86512652 missense probably benign 0.08
R0285:Dopey1 UTSW 9 86512639 missense probably damaging 1.00
R0415:Dopey1 UTSW 9 86506502 missense probably damaging 1.00
R0427:Dopey1 UTSW 9 86507532 missense probably damaging 1.00
R0514:Dopey1 UTSW 9 86520734 missense probably damaging 1.00
R0538:Dopey1 UTSW 9 86485497 missense probably damaging 1.00
R1118:Dopey1 UTSW 9 86515406 missense probably damaging 1.00
R1158:Dopey1 UTSW 9 86485556 missense probably damaging 1.00
R1272:Dopey1 UTSW 9 86521424 missense probably damaging 1.00
R1448:Dopey1 UTSW 9 86542732 splice site probably null
R1584:Dopey1 UTSW 9 86548172 nonsense probably null
R1601:Dopey1 UTSW 9 86536250 missense probably damaging 0.99
R1674:Dopey1 UTSW 9 86536160 missense probably damaging 0.98
R1706:Dopey1 UTSW 9 86554080 missense possibly damaging 0.92
R1856:Dopey1 UTSW 9 86492004 missense probably damaging 0.99
R1926:Dopey1 UTSW 9 86523019 missense probably damaging 1.00
R1929:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2029:Dopey1 UTSW 9 86521365 missense probably damaging 1.00
R2125:Dopey1 UTSW 9 86521046 missense probably damaging 1.00
R2206:Dopey1 UTSW 9 86521599 missense probably benign 0.00
R2271:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2312:Dopey1 UTSW 9 86521442 nonsense probably null
R2379:Dopey1 UTSW 9 86521085 missense probably damaging 1.00
R2507:Dopey1 UTSW 9 86513117 missense probably damaging 1.00
R3737:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R3804:Dopey1 UTSW 9 86520995 missense probably damaging 1.00
R3916:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R3921:Dopey1 UTSW 9 86520271 missense probably benign 0.06
R4035:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R4392:Dopey1 UTSW 9 86503143 intron probably benign
R4404:Dopey1 UTSW 9 86522813 nonsense probably null
R4513:Dopey1 UTSW 9 86520559 missense probably benign 0.39
R4624:Dopey1 UTSW 9 86521525 missense probably damaging 1.00
R4659:Dopey1 UTSW 9 86502032 intron probably benign
R4910:Dopey1 UTSW 9 86492061 missense probably damaging 1.00
R4919:Dopey1 UTSW 9 86520056 missense possibly damaging 0.47
R5061:Dopey1 UTSW 9 86503108 splice site probably benign
R5079:Dopey1 UTSW 9 86487421 missense probably damaging 1.00
R5118:Dopey1 UTSW 9 86506259 missense probably damaging 1.00
R5169:Dopey1 UTSW 9 86533021 missense probably damaging 1.00
R5176:Dopey1 UTSW 9 86521815 missense probably damaging 1.00
R5190:Dopey1 UTSW 9 86487304 missense probably damaging 1.00
R5256:Dopey1 UTSW 9 86515328 missense probably damaging 1.00
R5346:Dopey1 UTSW 9 86520782 missense probably damaging 1.00
R5484:Dopey1 UTSW 9 86545288 missense probably damaging 1.00
R5501:Dopey1 UTSW 9 86507730 missense probably benign 0.04
R5554:Dopey1 UTSW 9 86521657 missense probably damaging 1.00
R5707:Dopey1 UTSW 9 86502997 missense possibly damaging 0.95
R5826:Dopey1 UTSW 9 86507570 missense possibly damaging 0.94
R5921:Dopey1 UTSW 9 86501922 missense probably damaging 1.00
R5934:Dopey1 UTSW 9 86542442 nonsense probably null
R5936:Dopey1 UTSW 9 86536512 nonsense probably null
R6046:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R6053:Dopey1 UTSW 9 86515294 missense possibly damaging 0.95
R6104:Dopey1 UTSW 9 86520807 missense possibly damaging 0.86
R6125:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R6299:Dopey1 UTSW 9 86504212 missense probably damaging 1.00
R6930:Dopey1 UTSW 9 86531772 critical splice donor site probably null
R6949:Dopey1 UTSW 9 86500860 missense probably damaging 1.00
R6979:Dopey1 UTSW 9 86521642 missense possibly damaging 0.77
R7035:Dopey1 UTSW 9 86524302 missense possibly damaging 0.85
R7069:Dopey1 UTSW 9 86550169 critical splice donor site probably null
R7101:Dopey1 UTSW 9 86507669 missense probably benign
R7202:Dopey1 UTSW 9 86504167 splice site probably null
R7222:Dopey1 UTSW 9 86522876 critical splice donor site probably null
R7233:Dopey1 UTSW 9 86521696 missense probably benign 0.00
R7236:Dopey1 UTSW 9 86515378 missense probably damaging 1.00
R7252:Dopey1 UTSW 9 86500821 missense probably damaging 1.00
R7268:Dopey1 UTSW 9 86512777 nonsense probably null
R7353:Dopey1 UTSW 9 86512859 missense probably damaging 0.99
R7481:Dopey1 UTSW 9 86535932 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86506227 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86531750 missense probably damaging 0.98
ZE80:Dopey1 UTSW 9 86500842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGACCTATATTGAAATCCAGAC -3'
(R):5'- ATGTAGCTAATGTGGCTTAGGC -3'

Sequencing Primer
(F):5'- TATTGAAATCCAGACAGAACACCTGC -3'
(R):5'- AAGTGCATGATCACACTCATTTTCC -3'
Posted On2017-07-14