Incidental Mutation 'R6072:Asic2'
ID482546
Institutional Source Beutler Lab
Gene Symbol Asic2
Ensembl Gene ENSMUSG00000020704
Gene Nameacid-sensing (proton-gated) ion channel 2
SynonymsMdeg, BNC1, BNaC1a, Accn1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6072 (G1)
Quality Score89.0077
Status Not validated
Chromosome11
Chromosomal Location80880169-81968457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80894088 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 291 (S291P)
Ref Sequence ENSEMBL: ENSMUSP00000067095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021045] [ENSMUST00000066197]
Predicted Effect probably benign
Transcript: ENSMUST00000021045
AA Change: S342P

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021045
Gene: ENSMUSG00000020704
AA Change: S342P

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
Pfam:ASC 61 504 6.7e-94 PFAM
low complexity region 507 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066197
AA Change: S291P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067095
Gene: ENSMUSG00000020704
AA Change: S291P

DomainStartEndE-ValueType
Pfam:ASC 20 454 3.3e-177 PFAM
low complexity region 456 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mechanoreceptor and spiral ganglion electrophysiology and decreased pressure-induced blood vessel constriction. Mice homozygous for a different knock-out allele exhibit retinal degeneration and abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Asic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Asic2 APN 11 80894030 missense probably damaging 0.99
IGL02420:Asic2 APN 11 80881653 missense probably benign 0.05
IGL02451:Asic2 APN 11 80891737 splice site probably benign
LCD18:Asic2 UTSW 11 80985744 intron probably benign
R0682:Asic2 UTSW 11 80886680 missense possibly damaging 0.67
R0718:Asic2 UTSW 11 80971456 splice site probably benign
R0784:Asic2 UTSW 11 80893989 missense possibly damaging 0.92
R2679:Asic2 UTSW 11 81151954 missense probably benign 0.13
R2883:Asic2 UTSW 11 80894013 missense possibly damaging 0.61
R2991:Asic2 UTSW 11 81968037 missense probably benign
R4722:Asic2 UTSW 11 81968183 start codon destroyed probably null 0.00
R4770:Asic2 UTSW 11 80971492 missense probably benign 0.07
R4900:Asic2 UTSW 11 81573454 intron probably benign
R5005:Asic2 UTSW 11 80883426 missense probably damaging 1.00
R5056:Asic2 UTSW 11 80971603 missense possibly damaging 0.64
R5344:Asic2 UTSW 11 80971587 missense probably damaging 1.00
R5490:Asic2 UTSW 11 80889820 missense probably benign 0.02
R5722:Asic2 UTSW 11 81967980 missense probably benign 0.07
R6589:Asic2 UTSW 11 80886604 missense possibly damaging 0.79
R7068:Asic2 UTSW 11 81152255 missense probably benign 0.01
R7226:Asic2 UTSW 11 80971514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAGTATCTCCTTGCATCC -3'
(R):5'- TGGGAAACTTCATACAGGAGGC -3'

Sequencing Primer
(F):5'- TCCTCCAGGAGTGGGTGAG -3'
(R):5'- ATCCATGAGGCCAGAGGACC -3'
Posted On2017-07-14