Incidental Mutation 'R0517:2410137M14Rik'
List |< first << previous [record 97 of 19097] next >> last >|
ID48255
Institutional Source Beutler Lab
Gene Symbol 2410137M14Rik
Ensembl Gene ENSMUSG00000064308
Gene NameRIKEN cDNA 2410137M14 gene
Synonyms
MMRRC Submission 038710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R0517 (G1)
Quality Score178
Status Validated
Chromosome17
Chromosomal Location36977701-36981237 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 36981132 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039846] [ENSMUST00000173707]
Predicted Effect probably benign
Transcript: ENSMUST00000039846
SMART Domains Protein: ENSMUSP00000044846
Gene: ENSMUSG00000064308

DomainStartEndE-ValueType
IGc1 17 88 1.87e-12 SMART
transmembrane domain 105 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145260
Predicted Effect probably benign
Transcript: ENSMUST00000173707
SMART Domains Protein: ENSMUSP00000133725
Gene: ENSMUSG00000064308

DomainStartEndE-ValueType
IGc1 17 88 1.87e-12 SMART
low complexity region 109 125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,955,569 T194A probably benign Het
Adamts1 C A 16: 85,800,353 D10Y possibly damaging Het
Adamts7 T C 9: 90,199,858 V1612A probably benign Het
Adcyap1r1 T A 6: 55,491,297 S373T probably damaging Het
Armc4 A C 18: 7,223,621 L474R probably damaging Het
Asic5 A T 3: 82,009,526 I266F probably benign Het
Cacna1d A T 14: 30,179,275 I274K probably damaging Het
Camsap2 G T 1: 136,293,388 Q238K possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cerk G A 15: 86,156,648 T170I probably damaging Het
Cyp27b1 T C 10: 127,050,116 probably null Het
Cyp2c65 T C 19: 39,082,348 probably benign Het
Dennd5a A G 7: 109,934,761 S75P probably damaging Het
Dhx9 C T 1: 153,478,916 A146T possibly damaging Het
Dpysl5 A G 5: 30,778,066 D171G probably damaging Het
Dsg3 A G 18: 20,529,025 N449S probably benign Het
Eps8l3 T C 3: 107,883,460 S189P probably benign Het
Exph5 A G 9: 53,372,762 E381G probably benign Het
Fam208b T A 13: 3,566,964 T2367S possibly damaging Het
Fbxo46 A G 7: 19,136,874 M473V possibly damaging Het
Fgf14 G A 14: 123,983,784 P203S probably damaging Het
Foxf2 C T 13: 31,626,243 A55V unknown Het
Galnt5 T G 2: 58,035,373 probably benign Het
Glis2 T C 16: 4,611,552 L181P probably damaging Het
Gm1000 T G 12: 104,476,408 probably benign Het
Helz2 A G 2: 181,227,770 S2959P probably benign Het
Hyal6 A G 6: 24,734,853 N262D probably benign Het
Lgr4 T C 2: 110,011,320 L526P probably damaging Het
Mapk1 A T 16: 17,016,046 I88F probably benign Het
Mpg A T 11: 32,231,853 H287L probably benign Het
Mpp4 A T 1: 59,124,727 Y489* probably null Het
Mpzl1 T C 1: 165,601,790 E224G probably damaging Het
Myh10 A G 11: 68,811,599 probably null Het
Olfr1034 T C 2: 86,047,204 S241P probably damaging Het
Olfr1340 T A 4: 118,726,634 I129K probably damaging Het
Paip1 T A 13: 119,447,790 F196I probably damaging Het
Pde3a A T 6: 141,498,657 K1064* probably null Het
Pira2 A T 7: 3,844,197 probably benign Het
Pros1 A G 16: 62,903,518 S210G probably benign Het
Rbm15 A T 3: 107,331,369 L571Q probably damaging Het
Scn1a T A 2: 66,302,407 T1194S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Serpina1e G A 12: 103,949,227 T240I probably benign Het
Setx T G 2: 29,157,133 S1874R probably benign Het
Sgsm2 G T 11: 74,867,651 T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 V300A probably damaging Het
Spata46 A G 1: 170,311,609 Y59C probably damaging Het
Supt3 T C 17: 45,119,271 F404L probably benign Het
Tars T A 15: 11,394,366 K62* probably null Het
Tas2r139 A C 6: 42,141,491 T186P probably damaging Het
Tc2n C T 12: 101,649,195 S457N probably damaging Het
Tox4 A T 14: 52,292,628 S582C probably benign Het
Trappc12 T C 12: 28,697,134 probably benign Het
Ubqlnl G T 7: 104,148,638 Q551K probably damaging Het
Ubr4 A G 4: 139,392,124 T205A probably benign Het
Urb1 G A 16: 90,777,422 Q924* probably null Het
Vmn1r49 A G 6: 90,072,738 L94P probably damaging Het
Vmn2r120 T C 17: 57,508,949 Y802C probably damaging Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Other mutations in 2410137M14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:2410137M14Rik APN 17 36978807 missense probably damaging 0.98
IGL02972:2410137M14Rik APN 17 36978520 missense possibly damaging 0.85
R2044:2410137M14Rik UTSW 17 36978094 utr 3 prime probably benign
R2206:2410137M14Rik UTSW 17 36978073 utr 3 prime probably benign
R2207:2410137M14Rik UTSW 17 36978073 utr 3 prime probably benign
R4666:2410137M14Rik UTSW 17 36978902 missense probably benign 0.03
R4806:2410137M14Rik UTSW 17 36978854 missense probably benign 0.00
X0021:2410137M14Rik UTSW 17 36978034 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTGGTCAGCACCATGTCCCAG -3'
(R):5'- TGGCTAAGGCAAACCTCGGTTC -3'

Sequencing Primer
(F):5'- AGCACCATGTCCCAGGTTAG -3'
(R):5'- TTCACCGAGGCTACATGGAC -3'
Posted On2013-06-12