Incidental Mutation 'R6072:Slc1a3'
ID482552
Institutional Source Beutler Lab
Gene Symbol Slc1a3
Ensembl Gene ENSMUSG00000005360
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 3
SynonymsGLAST, MGluT1, Gmt1, B430115D02Rik, Eaat1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location8634124-8710764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8708568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 59 (I59F)
Ref Sequence ENSEMBL: ENSMUSP00000118902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005493] [ENSMUST00000157065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005493
AA Change: I59F

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005493
Gene: ENSMUSG00000005360
AA Change: I59F

DomainStartEndE-ValueType
Pfam:SDF 50 497 8.5e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153455
Predicted Effect probably damaging
Transcript: ENSMUST00000157065
AA Change: I59F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118902
Gene: ENSMUSG00000005360
AA Change: I59F

DomainStartEndE-ValueType
Pfam:SDF 50 119 4.7e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a member of a high affinity glutamate transporter family. This gene functions in the termination of excitatory neurotransmission in central nervous system. Mutations are associated with episodic ataxia, Type 6. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormalities with respect to appearance or survival but do display functional abnormalities related to the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Slc1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Slc1a3 APN 15 8645687 missense probably damaging 1.00
IGL01133:Slc1a3 APN 15 8650993 missense probably damaging 1.00
IGL01696:Slc1a3 APN 15 8642338 missense probably benign 0.19
IGL03108:Slc1a3 APN 15 8639078 missense probably damaging 1.00
R0128:Slc1a3 UTSW 15 8636209 missense probably benign 0.07
R0206:Slc1a3 UTSW 15 8708556 splice site probably benign
R0312:Slc1a3 UTSW 15 8636237 missense probably benign 0.00
R0385:Slc1a3 UTSW 15 8639135 missense probably damaging 1.00
R0538:Slc1a3 UTSW 15 8650922 missense probably benign
R0579:Slc1a3 UTSW 15 8688309 missense probably damaging 0.98
R1799:Slc1a3 UTSW 15 8688404 missense probably damaging 1.00
R2029:Slc1a3 UTSW 15 8645669 missense probably benign 0.29
R3236:Slc1a3 UTSW 15 8639123 missense probably damaging 0.98
R4494:Slc1a3 UTSW 15 8639095 missense probably damaging 1.00
R5010:Slc1a3 UTSW 15 8650846 splice site probably benign
R5154:Slc1a3 UTSW 15 8642949 missense probably benign 0.09
R5226:Slc1a3 UTSW 15 8642225 missense probably damaging 1.00
R5538:Slc1a3 UTSW 15 8645704 missense probably damaging 0.99
R6049:Slc1a3 UTSW 15 8645693 missense probably damaging 1.00
R6496:Slc1a3 UTSW 15 8649581 missense probably benign 0.01
R7015:Slc1a3 UTSW 15 8649568 missense probably damaging 1.00
R7168:Slc1a3 UTSW 15 8645902 missense possibly damaging 0.79
R7255:Slc1a3 UTSW 15 8642999 missense possibly damaging 0.90
R7476:Slc1a3 UTSW 15 8643084 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCATGTGTTCAGCTTCCAAC -3'
(R):5'- ACGCAAGGACGTGATAAATTCC -3'

Sequencing Primer
(F):5'- CCATGTGTTCAGCTTCCAACAAATG -3'
(R):5'- CAAGGACGTGATAAATTCCTAGAAAG -3'
Posted On2017-07-14