Incidental Mutation 'R6072:Nckap5l'
ID482553
Institutional Source Beutler Lab
Gene Symbol Nckap5l
Ensembl Gene ENSMUSG00000023009
Gene NameNCK-associated protein 5-like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6072 (G1)
Quality Score188.009
Status Not validated
Chromosome15
Chromosomal Location99422035-99457748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99426654 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 656 (L656Q)
Ref Sequence ENSEMBL: ENSMUSP00000023747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023747] [ENSMUST00000161948]
Predicted Effect probably damaging
Transcript: ENSMUST00000023747
AA Change: L656Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023747
Gene: ENSMUSG00000023009
AA Change: L656Q

DomainStartEndE-ValueType
coiled coil region 22 104 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 158 178 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 351 364 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
low complexity region 799 817 N/A INTRINSIC
Pfam:NCKAP5 871 1173 6.8e-89 PFAM
low complexity region 1205 1217 N/A INTRINSIC
low complexity region 1302 1318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160500
Predicted Effect probably benign
Transcript: ENSMUST00000161004
SMART Domains Protein: ENSMUSP00000125080
Gene: ENSMUSG00000023009

DomainStartEndE-ValueType
Pfam:NCKAP5 5 112 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161948
SMART Domains Protein: ENSMUSP00000123858
Gene: ENSMUSG00000023009

DomainStartEndE-ValueType
coiled coil region 22 104 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Nckap5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Nckap5l APN 15 99423127 unclassified probably benign
IGL02568:Nckap5l APN 15 99425683 missense probably damaging 1.00
IGL02615:Nckap5l APN 15 99429382 missense possibly damaging 0.89
IGL02896:Nckap5l APN 15 99427210 missense possibly damaging 0.89
R0653:Nckap5l UTSW 15 99423246 missense probably damaging 1.00
R1931:Nckap5l UTSW 15 99427261 missense probably damaging 1.00
R1969:Nckap5l UTSW 15 99422818 missense probably damaging 1.00
R4434:Nckap5l UTSW 15 99422863 missense probably benign
R4490:Nckap5l UTSW 15 99426130 missense probably benign 0.00
R4606:Nckap5l UTSW 15 99429323 unclassified probably benign
R4817:Nckap5l UTSW 15 99423186 missense probably damaging 1.00
R5008:Nckap5l UTSW 15 99425850 missense possibly damaging 0.68
R5011:Nckap5l UTSW 15 99426576 missense probably benign 0.20
R5013:Nckap5l UTSW 15 99426576 missense probably benign 0.20
R5503:Nckap5l UTSW 15 99425622 missense probably damaging 1.00
R5627:Nckap5l UTSW 15 99427706 missense possibly damaging 0.69
R5715:Nckap5l UTSW 15 99423576 missense probably benign 0.01
R6000:Nckap5l UTSW 15 99426885 missense probably damaging 1.00
R6104:Nckap5l UTSW 15 99423988 missense probably benign
R6198:Nckap5l UTSW 15 99425988 missense probably damaging 1.00
R6225:Nckap5l UTSW 15 99428024 missense possibly damaging 0.94
R6529:Nckap5l UTSW 15 99426594 missense probably benign 0.27
R6751:Nckap5l UTSW 15 99423161 missense probably damaging 1.00
R6866:Nckap5l UTSW 15 99426468 missense probably benign
R6869:Nckap5l UTSW 15 99426453 missense probably damaging 1.00
R7163:Nckap5l UTSW 15 99433473 missense probably damaging 0.98
R7174:Nckap5l UTSW 15 99424003 missense probably benign 0.09
R7239:Nckap5l UTSW 15 99426209 missense probably damaging 1.00
R7447:Nckap5l UTSW 15 99427476 missense probably damaging 1.00
R7479:Nckap5l UTSW 15 99423246 missense probably damaging 1.00
R7519:Nckap5l UTSW 15 99426247 missense not run
R7554:Nckap5l UTSW 15 99429380 missense not run
X0062:Nckap5l UTSW 15 99429410 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAAGATACCCTTAGCTTCTGGC -3'
(R):5'- AATTGACTCTGGAGGTGCCC -3'

Sequencing Primer
(F):5'- CTGCTCCAGAGGTCTTGC -3'
(R):5'- TCTGGAGGTGCCCCAGAC -3'
Posted On2017-07-14