Incidental Mutation 'R6072:3110001I22Rik'
ID482554
Institutional Source Beutler Lab
Gene Symbol 3110001I22Rik
Ensembl Gene ENSMUSG00000079737
Gene NameRIKEN cDNA 3110001I22 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location13671929-13678388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13677489 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 151 (S151P)
Ref Sequence ENSEMBL: ENSMUSP00000041742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023365] [ENSMUST00000035426] [ENSMUST00000069281] [ENSMUST00000127973]
Predicted Effect probably benign
Transcript: ENSMUST00000023365
SMART Domains Protein: ENSMUSP00000023365
Gene: ENSMUSG00000022684

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
transmembrane domain 142 164 N/A INTRINSIC
SAM 179 249 1.82e-6 SMART
transmembrane domain 361 380 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035426
AA Change: S151P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041742
Gene: ENSMUSG00000079737
AA Change: S151P

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 162 171 N/A INTRINSIC
Pfam:Lge1 226 301 8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069281
SMART Domains Protein: ENSMUSP00000063371
Gene: ENSMUSG00000022684

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
low complexity region 86 97 N/A INTRINSIC
PDB:1V85|A 98 123 2e-8 PDB
Blast:SAM 98 124 2e-8 BLAST
transmembrane domain 236 255 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127973
SMART Domains Protein: ENSMUSP00000115585
Gene: ENSMUSG00000022684

DomainStartEndE-ValueType
RING 34 73 2.71e-6 SMART
transmembrane domain 142 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230905
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in 3110001I22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0828:3110001I22Rik UTSW 16 13677805 missense probably damaging 1.00
R1961:3110001I22Rik UTSW 16 13677728 missense probably benign 0.04
R4630:3110001I22Rik UTSW 16 13677414 missense probably damaging 0.98
R5288:3110001I22Rik UTSW 16 13677758 missense probably benign 0.39
R5475:3110001I22Rik UTSW 16 13677113 missense possibly damaging 0.53
R6279:3110001I22Rik UTSW 16 13677270 missense probably damaging 0.99
R6515:3110001I22Rik UTSW 16 13676956 intron probably benign
R7138:3110001I22Rik UTSW 16 13677725 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTATAGATCAGAAGAACTCCCC -3'
(R):5'- CAGGTTCTTGTGGCTGATCC -3'

Sequencing Primer
(F):5'- TAGATCAGAAGAACTCCCCACACAG -3'
(R):5'- GGCTGATCCATAAGTTCTGAGAATCC -3'
Posted On2017-07-14