Incidental Mutation 'R6072:Rcan1'
ID482555
Institutional Source Beutler Lab
Gene Symbol Rcan1
Ensembl Gene ENSMUSG00000022951
Gene Nameregulator of calcineurin 1
SynonymsMCIP1, 2410048A02Rik, ADAPT78, Dscr1, CSP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6072 (G1)
Quality Score133.008
Status Not validated
Chromosome16
Chromosomal Location92391953-92470867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92465927 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000060394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060005] [ENSMUST00000232197] [ENSMUST00000232239]
Predicted Effect probably benign
Transcript: ENSMUST00000060005
AA Change: D51G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000060394
Gene: ENSMUSG00000022951
AA Change: D51G

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 39 46 N/A INTRINSIC
Pfam:Calcipressin 73 245 3.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231968
Predicted Effect probably benign
Transcript: ENSMUST00000232197
Predicted Effect probably benign
Transcript: ENSMUST00000232239
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Unstressed homozygous mutant mice show no overt phenotype other than a slight reduction in heart size and an impaired T helper 1 response. Stress-induced cardiac hypertrophy, however, is attenuated in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Rcan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0944:Rcan1 UTSW 16 92393491 missense probably damaging 1.00
R0973:Rcan1 UTSW 16 92393520 missense probably benign 0.04
R2303:Rcan1 UTSW 16 92393596 missense possibly damaging 0.80
R2340:Rcan1 UTSW 16 92397352 missense probably damaging 1.00
R3907:Rcan1 UTSW 16 92466029 utr 5 prime probably benign
R4352:Rcan1 UTSW 16 92393496 missense probably benign 0.11
R4857:Rcan1 UTSW 16 92465906 missense possibly damaging 0.77
R6991:Rcan1 UTSW 16 92397363 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCGTCTCCAGTGTCTGAGAC -3'
(R):5'- TAAAGGGAACGTTCTTGGGCTC -3'

Sequencing Primer
(F):5'- AGTGTCTGAGACCCCTGGAG -3'
(R):5'- AGAGCTACGATTCGAGGCC -3'
Posted On2017-07-14