Mutagenetix > Incidental Mutation

Incidental Mutation 'R6073:Ucp2'

482579

Institutional Source

Beutler Lab

Gene Symbol

Ucp2

Ensembl Gene

ENSMUSG00000033685

Gene Name

uncoupling protein 2 (mitochondrial, proton carrier)

Synonyms

MMRRC Submission

044234-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R6073 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100142565-100148832 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100147338 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 131 (V131M)

Ref Sequence

ENSEMBL: ENSMUSP00000120967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126534] [ENSMUST00000129324] [ENSMUST00000133044] [ENSMUST00000207748] [ENSMUST00000207405] [ENSMUST00000154516] [ENSMUST00000153287]

AlphaFold

P70406

PDB Structure

Structure of the mitochondrial uncoupling protein 2 determined by NMR molecular fragment replacement [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000054923

SMART Domains

Protein: ENSMUSP00000059074
Gene: ENSMUSG00000030708

Domain	Start	End	E-Value	Type
DnaJ	3	60	3.52e-23	SMART
Pfam:DnaJ_C	140	299	1.3e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126381

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126534
AA Change: V131M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120967
Gene: ENSMUSG00000033685
AA Change: V131M

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	111	1.3e-21	PFAM
Pfam:Mito_carr	112	208	2e-27	PFAM
Pfam:Mito_carr	211	302	5.7e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129324

SMART Domains

Protein: ENSMUSP00000115648
Gene: ENSMUSG00000033685

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	9	65	8.7e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130534

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133044
AA Change: V131M

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115598
Gene: ENSMUSG00000033685
AA Change: V131M

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	9	111	2.6e-23	PFAM
Pfam:Mito_carr	112	172	1.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133498

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207748
AA Change: V131M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000207405

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138673

Predicted Effect

probably benign
Transcript: ENSMUST00000154516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149808

Predicted Effect

probably benign
Transcript: ENSMUST00000153287

SMART Domains

Protein: ENSMUSP00000115953
Gene: ENSMUSG00000033685

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	9	111	6.4e-24	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.5%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have elevated pancreatic islet cell ATP levels and increased glucose-stimulated secretion of insulin. Homozygotes also show reduced mitochondrial proton leak in thymocytes and increased resistance to infection by Toxoplasma gondii. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adrb2	A	T	18: 62,312,537 (GRCm39)	M96K	probably benign	Het
Aox1	T	C	1: 58,143,668 (GRCm39)		probably null	Het
Bnip5	A	T	17: 29,123,597 (GRCm39)	V367D	probably damaging	Het
C3	C	T	17: 57,513,223 (GRCm39)	G183R	probably null	Het
Cad	A	G	5: 31,219,906 (GRCm39)	T753A	possibly damaging	Het
Cc2d2a	C	T	5: 43,887,317 (GRCm39)	T1249M	probably damaging	Het
Cd74	G	A	18: 60,944,558 (GRCm39)		probably null	Het
Cenpc1	A	G	5: 86,206,012 (GRCm39)		probably null	Het
Cenpe	T	A	3: 134,965,834 (GRCm39)	L2104*	probably null	Het
Cttnbp2	A	G	6: 18,434,232 (GRCm39)	I542T	probably damaging	Het
Cttnbp2	T	C	6: 18,448,368 (GRCm39)	D97G	probably benign	Het
Dnah10	A	G	5: 124,896,274 (GRCm39)	D3546G	probably benign	Het
Dscaml1	G	A	9: 45,361,881 (GRCm39)	V214I	probably benign	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Epb41l2	T	G	10: 25,377,730 (GRCm39)	H597Q	probably damaging	Het
Erbin	G	A	13: 103,981,429 (GRCm39)	Q499*	probably null	Het
Erc2	A	T	14: 27,733,593 (GRCm39)	I556F	probably benign	Het
Fscn2	G	T	11: 120,252,613 (GRCm39)	E27*	probably null	Het
Fsd1l	A	G	4: 53,679,994 (GRCm39)	T231A	probably damaging	Het
G6pc1	T	A	11: 101,258,802 (GRCm39)	N60K	probably benign	Het
Gm43302	A	G	5: 105,438,825 (GRCm39)	V21A	probably damaging	Het
Heatr3	G	T	8: 88,864,768 (GRCm39)	A41S	probably benign	Het
Hrct1	T	C	4: 43,727,543 (GRCm39)		probably benign	Het
Ihh	T	C	1: 74,990,438 (GRCm39)		probably benign	Het
Jph3	A	T	8: 122,480,291 (GRCm39)	Y323F	probably damaging	Het
Kcnj5	T	C	9: 32,229,096 (GRCm39)	D34G	probably damaging	Het
Magi2	G	A	5: 20,774,286 (GRCm39)	E231K	probably damaging	Het
Muc5b	A	C	7: 141,412,025 (GRCm39)	Y1657S	unknown	Het
Muc5b	G	A	7: 141,402,797 (GRCm39)	C667Y	unknown	Het
Myo10	G	A	15: 25,736,728 (GRCm39)	C459Y	probably damaging	Het
Nemp1	A	G	10: 127,525,112 (GRCm39)	K40E	probably benign	Het
Nipsnap1	T	C	11: 4,838,895 (GRCm39)	F107S	possibly damaging	Het
Ntrk1	T	C	3: 87,698,677 (GRCm39)		probably null	Het
Pabpc1	A	G	15: 36,600,895 (GRCm39)	I305T	probably damaging	Het
Piezo2	A	G	18: 63,145,716 (GRCm39)	F2736S	probably damaging	Het
Pnldc1	T	C	17: 13,109,250 (GRCm39)	Y450C	probably null	Het
Polr2g	A	T	19: 8,774,673 (GRCm39)	V70E	probably damaging	Het
Pramel23	T	C	4: 143,424,838 (GRCm39)	I202V	probably damaging	Het
Prpf8	T	C	11: 75,384,848 (GRCm39)		probably null	Het
Rfxap	T	C	3: 54,714,708 (GRCm39)	Y130C	probably damaging	Het
Rpl3l	A	G	17: 24,949,861 (GRCm39)	E20G	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,229,113 (GRCm39)		probably benign	Het
Slc39a10	T	C	1: 46,871,772 (GRCm39)	D389G	possibly damaging	Het
Sorbs1	T	C	19: 40,303,101 (GRCm39)	H496R	probably damaging	Het
Spast	G	A	17: 74,680,300 (GRCm39)	V420M	probably damaging	Het
Spata13	C	T	14: 60,987,470 (GRCm39)	T876I	probably damaging	Het
Spata31d1a	T	A	13: 59,850,808 (GRCm39)	N440I	probably damaging	Het
Tdrd1	G	T	19: 56,831,655 (GRCm39)	E349*	probably null	Het
Tie1	A	G	4: 118,339,587 (GRCm39)	V398A	probably benign	Het
Tmem255b	T	A	8: 13,506,958 (GRCm39)	L229Q	probably damaging	Het
Tmem59	T	A	4: 107,050,598 (GRCm39)		probably null	Het
Trim3	G	A	7: 105,266,746 (GRCm39)	R479C	probably damaging	Het
Vars1	A	G	17: 35,220,505 (GRCm39)	D29G	probably benign	Het
Vmn2r43	T	C	7: 8,258,184 (GRCm39)	K343R	probably benign	Het
Washc5	T	C	15: 59,207,019 (GRCm39)	K1085E	possibly damaging	Het
Zfp647	G	A	15: 76,796,285 (GRCm39)	P125L	probably damaging	Het
Zfp963	A	T	8: 70,195,853 (GRCm39)	C86*	probably null	Het
Zfp977	A	G	7: 42,230,165 (GRCm39)	I120T	probably benign	Het

Other mutations in Ucp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00953:Ucp2	APN	7	100,147,629 (GRCm39)	missense	probably benign
IGL02184:Ucp2	APN	7	100,148,529 (GRCm39)	missense	probably benign
IGL02370:Ucp2	APN	7	100,147,591 (GRCm39)	missense	probably damaging	0.96
IGL02449:Ucp2	APN	7	100,148,017 (GRCm39)	missense	probably damaging	1.00
R1808:Ucp2	UTSW	7	100,148,021 (GRCm39)	missense	probably damaging	0.97
R1809:Ucp2	UTSW	7	100,147,606 (GRCm39)	missense	probably damaging	0.98
R2384:Ucp2	UTSW	7	100,147,461 (GRCm39)	missense	probably benign
R2508:Ucp2	UTSW	7	100,147,620 (GRCm39)	missense	probably benign
R2866:Ucp2	UTSW	7	100,146,459 (GRCm39)	missense	probably benign	0.31
R4400:Ucp2	UTSW	7	100,148,557 (GRCm39)	makesense	probably null
R5022:Ucp2	UTSW	7	100,147,579 (GRCm39)	missense	possibly damaging	0.74
R6530:Ucp2	UTSW	7	100,147,430 (GRCm39)	missense	probably benign
R7381:Ucp2	UTSW	7	100,147,576 (GRCm39)	missense	possibly damaging	0.94
R7572:Ucp2	UTSW	7	100,146,514 (GRCm39)	critical splice donor site	probably null
R9377:Ucp2	UTSW	7	100,146,040 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCAAGAGTGATCTAGAGCCTC -3'
(R):5'- CATTACGGGCAACATTGGGAG -3'

Posted On

2017-07-14