Mutagenetix > Incidental Mutation

Incidental Mutation 'R6073:Piezo2'

482611

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik

MMRRC Submission

044234-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6073 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63143284-63520254 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63145716 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 2736 (F2736S)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: F2736S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: F2736S

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137141

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.5547

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.5%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adrb2	A	T	18: 62,312,537 (GRCm39)	M96K	probably benign	Het
Aox1	T	C	1: 58,143,668 (GRCm39)		probably null	Het
Bnip5	A	T	17: 29,123,597 (GRCm39)	V367D	probably damaging	Het
C3	C	T	17: 57,513,223 (GRCm39)	G183R	probably null	Het
Cad	A	G	5: 31,219,906 (GRCm39)	T753A	possibly damaging	Het
Cc2d2a	C	T	5: 43,887,317 (GRCm39)	T1249M	probably damaging	Het
Cd74	G	A	18: 60,944,558 (GRCm39)		probably null	Het
Cenpc1	A	G	5: 86,206,012 (GRCm39)		probably null	Het
Cenpe	T	A	3: 134,965,834 (GRCm39)	L2104*	probably null	Het
Cttnbp2	A	G	6: 18,434,232 (GRCm39)	I542T	probably damaging	Het
Cttnbp2	T	C	6: 18,448,368 (GRCm39)	D97G	probably benign	Het
Dnah10	A	G	5: 124,896,274 (GRCm39)	D3546G	probably benign	Het
Dscaml1	G	A	9: 45,361,881 (GRCm39)	V214I	probably benign	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Epb41l2	T	G	10: 25,377,730 (GRCm39)	H597Q	probably damaging	Het
Erbin	G	A	13: 103,981,429 (GRCm39)	Q499*	probably null	Het
Erc2	A	T	14: 27,733,593 (GRCm39)	I556F	probably benign	Het
Fscn2	G	T	11: 120,252,613 (GRCm39)	E27*	probably null	Het
Fsd1l	A	G	4: 53,679,994 (GRCm39)	T231A	probably damaging	Het
G6pc1	T	A	11: 101,258,802 (GRCm39)	N60K	probably benign	Het
Gm43302	A	G	5: 105,438,825 (GRCm39)	V21A	probably damaging	Het
Heatr3	G	T	8: 88,864,768 (GRCm39)	A41S	probably benign	Het
Hrct1	T	C	4: 43,727,543 (GRCm39)		probably benign	Het
Ihh	T	C	1: 74,990,438 (GRCm39)		probably benign	Het
Jph3	A	T	8: 122,480,291 (GRCm39)	Y323F	probably damaging	Het
Kcnj5	T	C	9: 32,229,096 (GRCm39)	D34G	probably damaging	Het
Magi2	G	A	5: 20,774,286 (GRCm39)	E231K	probably damaging	Het
Muc5b	A	C	7: 141,412,025 (GRCm39)	Y1657S	unknown	Het
Muc5b	G	A	7: 141,402,797 (GRCm39)	C667Y	unknown	Het
Myo10	G	A	15: 25,736,728 (GRCm39)	C459Y	probably damaging	Het
Nemp1	A	G	10: 127,525,112 (GRCm39)	K40E	probably benign	Het
Nipsnap1	T	C	11: 4,838,895 (GRCm39)	F107S	possibly damaging	Het
Ntrk1	T	C	3: 87,698,677 (GRCm39)		probably null	Het
Pabpc1	A	G	15: 36,600,895 (GRCm39)	I305T	probably damaging	Het
Pnldc1	T	C	17: 13,109,250 (GRCm39)	Y450C	probably null	Het
Polr2g	A	T	19: 8,774,673 (GRCm39)	V70E	probably damaging	Het
Pramel23	T	C	4: 143,424,838 (GRCm39)	I202V	probably damaging	Het
Prpf8	T	C	11: 75,384,848 (GRCm39)		probably null	Het
Rfxap	T	C	3: 54,714,708 (GRCm39)	Y130C	probably damaging	Het
Rpl3l	A	G	17: 24,949,861 (GRCm39)	E20G	probably benign	Het
Rsf1	GGCGGCGGC	GGCGGCGGCCGCGGCGGC	7: 97,229,113 (GRCm39)		probably benign	Het
Slc39a10	T	C	1: 46,871,772 (GRCm39)	D389G	possibly damaging	Het
Sorbs1	T	C	19: 40,303,101 (GRCm39)	H496R	probably damaging	Het
Spast	G	A	17: 74,680,300 (GRCm39)	V420M	probably damaging	Het
Spata13	C	T	14: 60,987,470 (GRCm39)	T876I	probably damaging	Het
Spata31d1a	T	A	13: 59,850,808 (GRCm39)	N440I	probably damaging	Het
Tdrd1	G	T	19: 56,831,655 (GRCm39)	E349*	probably null	Het
Tie1	A	G	4: 118,339,587 (GRCm39)	V398A	probably benign	Het
Tmem255b	T	A	8: 13,506,958 (GRCm39)	L229Q	probably damaging	Het
Tmem59	T	A	4: 107,050,598 (GRCm39)		probably null	Het
Trim3	G	A	7: 105,266,746 (GRCm39)	R479C	probably damaging	Het
Ucp2	G	A	7: 100,147,338 (GRCm39)	V131M	possibly damaging	Het
Vars1	A	G	17: 35,220,505 (GRCm39)	D29G	probably benign	Het
Vmn2r43	T	C	7: 8,258,184 (GRCm39)	K343R	probably benign	Het
Washc5	T	C	15: 59,207,019 (GRCm39)	K1085E	possibly damaging	Het
Zfp647	G	A	15: 76,796,285 (GRCm39)	P125L	probably damaging	Het
Zfp963	A	T	8: 70,195,853 (GRCm39)	C86*	probably null	Het
Zfp977	A	G	7: 42,230,165 (GRCm39)	I120T	probably benign	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,250,770 (GRCm39)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,155,531 (GRCm39)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,203,101 (GRCm39)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,257,685 (GRCm39)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,163,463 (GRCm39)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,315,904 (GRCm39)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,160,630 (GRCm39)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,216,241 (GRCm39)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,175,859 (GRCm39)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,225,915 (GRCm39)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,153,705 (GRCm39)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,279,915 (GRCm39)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,205,933 (GRCm39)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,165,995 (GRCm39)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,157,546 (GRCm39)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,207,730 (GRCm39)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,197,856 (GRCm39)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,257,731 (GRCm39)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,203,146 (GRCm39)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,163,343 (GRCm39)	splice site	probably null
IGL03129:Piezo2	APN	18	63,248,043 (GRCm39)	missense	probably benign
IGL03143:Piezo2	APN	18	63,241,147 (GRCm39)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,144,669 (GRCm39)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,257,677 (GRCm39)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,186,133 (GRCm39)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,174,791 (GRCm39)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,144,609 (GRCm39)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,154,379 (GRCm39)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,160,775 (GRCm39)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
sopranino	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
woodwind	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,519,271 (GRCm39)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,157,540 (GRCm39)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,235,155 (GRCm39)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,157,562 (GRCm39)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,162,132 (GRCm39)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,235,245 (GRCm39)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,157,522 (GRCm39)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,160,615 (GRCm39)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,155,552 (GRCm39)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,155,497 (GRCm39)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,152,329 (GRCm39)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,174,794 (GRCm39)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,216,306 (GRCm39)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,148,873 (GRCm39)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,219,824 (GRCm39)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,154,325 (GRCm39)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,216,202 (GRCm39)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,277,990 (GRCm39)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,215,986 (GRCm39)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,250,743 (GRCm39)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,154,244 (GRCm39)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,239,355 (GRCm39)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,241,158 (GRCm39)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,165,911 (GRCm39)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,152,415 (GRCm39)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,247,031 (GRCm39)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,211,911 (GRCm39)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,211,852 (GRCm39)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,277,997 (GRCm39)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,192,815 (GRCm39)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,252,006 (GRCm39)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,214,805 (GRCm39)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,250,791 (GRCm39)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,247,112 (GRCm39)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,239,345 (GRCm39)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,155,596 (GRCm39)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,378,695 (GRCm39)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,186,106 (GRCm39)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,279,914 (GRCm39)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,157,506 (GRCm39)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,175,903 (GRCm39)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,214,864 (GRCm39)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,183,675 (GRCm39)	missense	probably benign
R4181:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,217,911 (GRCm39)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,235,170 (GRCm39)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,247,134 (GRCm39)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,205,951 (GRCm39)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,219,699 (GRCm39)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,203,034 (GRCm39)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,278,025 (GRCm39)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,211,862 (GRCm39)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,290,333 (GRCm39)	missense	probably benign
R4961:Piezo2	UTSW	18	63,186,032 (GRCm39)	splice site	probably null
R4968:Piezo2	UTSW	18	63,278,042 (GRCm39)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,207,751 (GRCm39)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,216,184 (GRCm39)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,157,607 (GRCm39)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,207,691 (GRCm39)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,163,480 (GRCm39)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,166,000 (GRCm39)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,197,802 (GRCm39)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,217,811 (GRCm39)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,278,176 (GRCm39)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,160,935 (GRCm39)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,144,792 (GRCm39)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,278,162 (GRCm39)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,250,768 (GRCm39)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,250,767 (GRCm39)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,279,927 (GRCm39)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,160,972 (GRCm39)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,247,005 (GRCm39)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6198:Piezo2	UTSW	18	63,290,281 (GRCm39)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,254,341 (GRCm39)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,250,749 (GRCm39)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,239,364 (GRCm39)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,219,678 (GRCm39)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,174,734 (GRCm39)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,239,342 (GRCm39)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,154,399 (GRCm39)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,154,333 (GRCm39)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,165,960 (GRCm39)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,223,950 (GRCm39)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,166,057 (GRCm39)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,216,032 (GRCm39)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,278,181 (GRCm39)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,257,780 (GRCm39)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,241,101 (GRCm39)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,150,590 (GRCm39)	splice site	probably null
R7395:Piezo2	UTSW	18	63,160,634 (GRCm39)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,157,543 (GRCm39)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,145,794 (GRCm39)	missense	probably benign
R7517:Piezo2	UTSW	18	63,215,996 (GRCm39)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,186,081 (GRCm39)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,175,610 (GRCm39)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,246,947 (GRCm39)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,216,016 (GRCm39)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,216,271 (GRCm39)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,175,882 (GRCm39)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,163,537 (GRCm39)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,208,801 (GRCm39)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,145,857 (GRCm39)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,217,759 (GRCm39)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,178,611 (GRCm39)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,279,873 (GRCm39)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,225,971 (GRCm39)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,226,086 (GRCm39)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8727:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8810:Piezo2	UTSW	18	63,248,034 (GRCm39)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,248,096 (GRCm39)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,225,902 (GRCm39)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,178,550 (GRCm39)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,250,815 (GRCm39)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,290,302 (GRCm39)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,154,372 (GRCm39)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,208,868 (GRCm39)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,157,637 (GRCm39)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,162,156 (GRCm39)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,235,236 (GRCm39)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,519,347 (GRCm39)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,280,016 (GRCm39)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,248,108 (GRCm39)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,197,767 (GRCm39)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,160,657 (GRCm39)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,183,681 (GRCm39)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,150,648 (GRCm39)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,203,065 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGGCAGTCTTTGGACCTCTTG -3'
(R):5'- AAGTCCTGAGACCCTCATGC -3'

Posted On

2017-07-14