Incidental Mutation 'R6074:Ppp1r13b'
ID482658
Institutional Source Beutler Lab
Gene Symbol Ppp1r13b
Ensembl Gene ENSMUSG00000021285
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13B
SynonymsASPP1
MMRRC Submission 044235-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R6074 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111828457-111908110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111832402 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 919 (I919T)
Ref Sequence ENSEMBL: ENSMUSP00000062464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021714] [ENSMUST00000054815] [ENSMUST00000220486] [ENSMUST00000221375] [ENSMUST00000222843]
Predicted Effect probably benign
Transcript: ENSMUST00000021714
SMART Domains Protein: ENSMUSP00000021714
Gene: ENSMUSG00000021286

DomainStartEndE-ValueType
FYVE 36 105 7.11e-16 SMART
Pfam:ZFYVE21_C 108 233 1.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054815
AA Change: I919T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062464
Gene: ENSMUSG00000021285
AA Change: I919T

DomainStartEndE-ValueType
PDB:2UWQ|A 1 83 8e-35 PDB
Blast:RA 5 84 3e-47 BLAST
coiled coil region 123 305 N/A INTRINSIC
low complexity region 437 476 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
PDB:4IRV|H 695 741 1e-12 PDB
ANK 917 946 4.16e-7 SMART
ANK 950 979 4.63e-5 SMART
SH3 1019 1077 1.79e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220486
AA Change: I796T

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000221375
Predicted Effect probably benign
Transcript: ENSMUST00000222843
Predicted Effect probably benign
Transcript: ENSMUST00000223211
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53-family proteins. They promote DNA binding and transactivation of p53-family proteins on the promoters of proapoptotic genes. Expression of this gene is regulated by the E2F transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants show lymphatic vascular phenotypes with subcutaneous edema detected only during embryogenesis, delayed lymphatic vessel formation, and mispatterned collecting lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 T A 3: 108,191,693 C189* probably null Het
Auts2 G T 5: 131,476,989 probably benign Het
Cadps2 C A 6: 23,626,671 W177L probably damaging Het
Camk2b G T 11: 5,989,635 P223Q probably damaging Het
Ccdc74a C A 16: 17,646,727 S9* probably null Het
Ccnt1 A C 15: 98,543,324 Y688D probably damaging Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ceacam3 C T 7: 17,151,559 T29I probably benign Het
Cep170b T C 12: 112,744,155 S1473P probably damaging Het
Col19a1 T A 1: 24,526,483 T256S unknown Het
Eif2d T A 1: 131,166,342 D423E probably damaging Het
Fam13a A G 6: 58,989,738 probably null Het
Fam84a G A 12: 14,150,511 H72Y probably benign Het
Gaa G A 11: 119,284,186 R871H probably benign Het
Galnt12 T A 4: 47,112,405 V37D probably damaging Het
Glp2r A G 11: 67,746,814 S13P unknown Het
Gnptab C T 10: 88,433,078 L548F probably damaging Het
Heg1 C T 16: 33,727,203 P787S possibly damaging Het
Hivep2 T A 10: 14,131,741 M1361K probably benign Het
Hivep3 T C 4: 120,097,694 I1069T possibly damaging Het
Hspg2 A G 4: 137,540,735 D2121G probably benign Het
Htatip2 A G 7: 49,772,574 probably null Het
Ighv1-75 T C 12: 115,834,387 S4G probably benign Het
Ip6k1 A G 9: 108,024,109 probably benign Het
Kcna6 A G 6: 126,739,279 S216P probably benign Het
Kif21a T A 15: 90,980,892 T526S probably benign Het
Kng2 C T 16: 23,000,596 G230D probably benign Het
Lgi2 A T 5: 52,546,642 F216I probably benign Het
Lss T A 10: 76,543,859 N383K probably damaging Het
Mical1 T C 10: 41,486,065 M929T probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nat8f4 A G 6: 85,901,187 V118A probably damaging Het
Olfr1198 A C 2: 88,746,222 L222R probably damaging Het
Olfr1416 G A 1: 92,479,775 T282M probably benign Het
Olfr16 T A 1: 172,957,378 N194K probably benign Het
Osbpl11 T A 16: 33,209,965 S188T probably benign Het
Pea15a C T 1: 172,199,185 R85H possibly damaging Het
Rasgrf1 A G 9: 89,953,915 D232G probably benign Het
Rp1 A G 1: 4,345,379 S1837P probably benign Het
Samd5 T A 10: 9,674,590 Y125F possibly damaging Het
Skint5 T C 4: 113,805,200 T597A unknown Het
Slc25a12 A G 2: 71,276,454 F605L probably benign Het
Slc39a12 C T 2: 14,407,479 Q321* probably null Het
Slc6a19 T C 13: 73,689,763 S206G probably benign Het
Tacc2 T A 7: 130,625,435 H1283Q possibly damaging Het
Thumpd3 A G 6: 113,060,010 E290G possibly damaging Het
Timd2 C T 11: 46,687,172 G44D possibly damaging Het
Tmem74 A G 15: 43,866,738 V303A possibly damaging Het
Tpo A G 12: 30,078,187 V785A probably benign Het
Tpra1 T A 6: 88,911,937 I367N possibly damaging Het
Txnrd2 T C 16: 18,437,547 I95T probably damaging Het
Usp32 A G 11: 84,994,573 V1216A probably benign Het
Usp54 C A 14: 20,552,099 M1394I probably benign Het
Vmn2r13 A G 5: 109,174,301 F177L probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Wdfy4 C T 14: 33,083,639 probably null Het
Wnk2 A T 13: 49,051,399 C458S probably damaging Het
Xkr6 T G 14: 63,607,070 F181V possibly damaging Het
Zfp212 T A 6: 47,927,052 C149* probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp661 A G 2: 127,577,873 S116P probably benign Het
Zfp770 A G 2: 114,196,389 Y400H possibly damaging Het
Other mutations in Ppp1r13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ppp1r13b APN 12 111829370 missense probably damaging 0.99
IGL01102:Ppp1r13b APN 12 111833219 missense probably benign
IGL01621:Ppp1r13b APN 12 111835092 missense possibly damaging 0.50
IGL01677:Ppp1r13b APN 12 111843665 missense probably benign 0.18
IGL01720:Ppp1r13b APN 12 111858260 missense probably benign 0.05
IGL01921:Ppp1r13b APN 12 111833237 missense probably benign
IGL02059:Ppp1r13b APN 12 111833347 missense probably damaging 1.00
IGL02187:Ppp1r13b APN 12 111835038 missense probably damaging 0.99
IGL02262:Ppp1r13b APN 12 111835211 missense possibly damaging 0.88
IGL02385:Ppp1r13b APN 12 111835043 missense probably damaging 1.00
IGL02894:Ppp1r13b APN 12 111831454 unclassified probably benign
IGL03027:Ppp1r13b APN 12 111830396 nonsense probably null
IGL03049:Ppp1r13b APN 12 111833229 missense probably benign 0.29
PIT4468001:Ppp1r13b UTSW 12 111838702 missense probably benign 0.08
PIT4472001:Ppp1r13b UTSW 12 111832640 missense probably damaging 1.00
R0393:Ppp1r13b UTSW 12 111835688 missense probably benign 0.01
R0561:Ppp1r13b UTSW 12 111866446 missense probably damaging 1.00
R1067:Ppp1r13b UTSW 12 111835116 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1512:Ppp1r13b UTSW 12 111872408 missense possibly damaging 0.84
R1563:Ppp1r13b UTSW 12 111840982 missense probably damaging 1.00
R1918:Ppp1r13b UTSW 12 111834810 missense probably damaging 1.00
R2014:Ppp1r13b UTSW 12 111833788 missense probably benign
R2134:Ppp1r13b UTSW 12 111833733 missense probably benign 0.00
R2306:Ppp1r13b UTSW 12 111844893 missense probably damaging 1.00
R3508:Ppp1r13b UTSW 12 111872367 missense probably damaging 1.00
R3767:Ppp1r13b UTSW 12 111846417 missense probably damaging 0.99
R4237:Ppp1r13b UTSW 12 111838736 missense probably benign
R4278:Ppp1r13b UTSW 12 111830384 missense probably damaging 0.96
R4690:Ppp1r13b UTSW 12 111832558 missense probably damaging 1.00
R4702:Ppp1r13b UTSW 12 111833281 missense probably benign 0.00
R5094:Ppp1r13b UTSW 12 111843610 missense probably benign 0.00
R5250:Ppp1r13b UTSW 12 111844960 missense probably benign 0.20
R5444:Ppp1r13b UTSW 12 111838688 missense probably benign
R5607:Ppp1r13b UTSW 12 111833789 missense probably benign 0.44
R5874:Ppp1r13b UTSW 12 111844989 missense probably damaging 1.00
R5935:Ppp1r13b UTSW 12 111830442 missense probably benign
R6253:Ppp1r13b UTSW 12 111835726 missense probably benign
R6511:Ppp1r13b UTSW 12 111831567 missense probably damaging 1.00
R6836:Ppp1r13b UTSW 12 111835195 missense probably benign 0.16
R6968:Ppp1r13b UTSW 12 111833178 missense possibly damaging 0.76
R7269:Ppp1r13b UTSW 12 111834919 missense probably damaging 0.99
R7284:Ppp1r13b UTSW 12 111834966 missense possibly damaging 0.82
R7304:Ppp1r13b UTSW 12 111872406 missense possibly damaging 0.49
R7314:Ppp1r13b UTSW 12 111846356 missense probably damaging 1.00
X0010:Ppp1r13b UTSW 12 111831459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAGCTTGAATCACCTCTTCC -3'
(R):5'- CCTAACTCTGAACGGACAGG -3'

Posted On2017-07-14