Incidental Mutation 'R6075:Gpr107'
ID482681
Institutional Source Beutler Lab
Gene Symbol Gpr107
Ensembl Gene ENSMUSG00000000194
Gene NameG protein-coupled receptor 107
Synonyms
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6075 (G1)
Quality Score169.009
Status Not validated
Chromosome2
Chromosomal Location31152316-31218775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31152372 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 5 (V5E)
Ref Sequence ENSEMBL: ENSMUSP00000056739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056433]
Predicted Effect probably benign
Transcript: ENSMUST00000056433
AA Change: V5E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000056739
Gene: ENSMUSG00000000194
AA Change: V5E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lung_7-TM_R 213 504 3e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194084
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes complete embryonic lethality during organogenesis, associated with reduced expression of genes implicated in the cubilin-megalin multi-ligand endocytic receptor complex. Homozygous null MEFs show defects in receptor-mediated endocytosis and recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Gpr107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gpr107 APN 2 31171994 missense probably benign 0.00
IGL00828:Gpr107 APN 2 31177783 critical splice acceptor site probably null
IGL01138:Gpr107 APN 2 31172016 missense probably benign 0.06
IGL01589:Gpr107 APN 2 31167151 splice site probably benign
IGL02164:Gpr107 APN 2 31178286 nonsense probably null
IGL02176:Gpr107 APN 2 31168846 missense probably benign 0.01
IGL02190:Gpr107 APN 2 31178320 missense probably damaging 1.00
IGL02234:Gpr107 APN 2 31177833 missense probably damaging 1.00
IGL02838:Gpr107 APN 2 31214317 missense probably benign 0.01
PIT4142001:Gpr107 UTSW 2 31167071 missense probably benign 0.18
R0613:Gpr107 UTSW 2 31178285 missense probably damaging 1.00
R0630:Gpr107 UTSW 2 31214297 missense possibly damaging 0.89
R0735:Gpr107 UTSW 2 31171994 missense probably benign 0.00
R1263:Gpr107 UTSW 2 31178255 missense possibly damaging 0.82
R1572:Gpr107 UTSW 2 31167025 missense probably damaging 1.00
R1675:Gpr107 UTSW 2 31167051 missense possibly damaging 0.77
R2421:Gpr107 UTSW 2 31185529 missense probably damaging 1.00
R4569:Gpr107 UTSW 2 31207665 splice site probably benign
R4647:Gpr107 UTSW 2 31210501 missense probably damaging 1.00
R4656:Gpr107 UTSW 2 31214249 missense probably damaging 1.00
R4844:Gpr107 UTSW 2 31188674 splice site probably null
R5385:Gpr107 UTSW 2 31214251 missense probably benign 0.01
R5416:Gpr107 UTSW 2 31185548 missense probably damaging 1.00
R5562:Gpr107 UTSW 2 31152363 missense probably damaging 1.00
R5564:Gpr107 UTSW 2 31152363 missense probably damaging 1.00
R5652:Gpr107 UTSW 2 31185589 missense probably benign 0.16
R7186:Gpr107 UTSW 2 31152359 start codon destroyed possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- CCAATTGAAGAGTGCCGAGG -3'
(R):5'- GAACTTAGGAGATCCCGCTG -3'

Posted On2017-07-14