Mutagenetix > Incidental Mutation

Incidental Mutation 'R6075:Zfyve26'

482712

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, 9330197E15Rik, LOC380767

MMRRC Submission

044236-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6075 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79279120-79343078 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79340628 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 82 (V82A)

Ref Sequence

ENSEMBL: ENSMUSP00000151280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000079533] [ENSMUST00000171210] [ENSMUST00000218039] [ENSMUST00000218377]

AlphaFold

Q5DU37

Predicted Effect

probably benign
Transcript: ENSMUST00000021547
AA Change: V82A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: V82A

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079533

SMART Domains

Protein: ENSMUSP00000078490
Gene: ENSMUSG00000059060

Domain	Start	End	E-Value	Type
Pfam:Rad51	61	256	3.1e-32	PFAM
Pfam:AAA_25	68	249	1.1e-15	PFAM
Pfam:KaiC	83	240	1.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171210

SMART Domains

Protein: ENSMUSP00000128357
Gene: ENSMUSG00000059060

Domain	Start	End	E-Value	Type
Pfam:Rad51	61	256	3e-33	PFAM
Pfam:AAA_25	68	241	2.8e-16	PFAM
Pfam:KaiC	83	241	3.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218039

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218377
AA Change: V82A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219571

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219842

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	G	T	18: 67,554,329 (GRCm39)	L458M	probably damaging	Het
Ank3	G	A	10: 69,838,395 (GRCm39)	R1566K	possibly damaging	Het
Areg	A	T	5: 91,291,456 (GRCm39)	K133M	probably damaging	Het
Atxn2l	A	T	7: 126,091,689 (GRCm39)	D1076E	possibly damaging	Het
Barhl1	T	C	2: 28,805,231 (GRCm39)	Y154C	probably damaging	Het
BC048507	A	G	13: 68,011,823 (GRCm39)	T67A	probably benign	Het
Cacna1g	T	A	11: 94,307,491 (GRCm39)	I1746F	probably damaging	Het
Ccdc34	T	C	2: 109,874,580 (GRCm39)	I313T	possibly damaging	Het
Cma1	T	A	14: 56,179,771 (GRCm39)	I138F	probably damaging	Het
Col5a2	A	G	1: 45,542,008 (GRCm39)	S23P	unknown	Het
Csmd2	C	A	4: 128,380,658 (GRCm39)	S2071R	probably benign	Het
Cyp2j11	T	G	4: 96,233,322 (GRCm39)	N125H	probably benign	Het
Dchs2	A	G	3: 83,262,368 (GRCm39)	R2879G	possibly damaging	Het
Dnah11	A	T	12: 118,068,586 (GRCm39)	C1591S	probably damaging	Het
Dock9	C	T	14: 121,783,385 (GRCm39)	R2038H	probably benign	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Fbxo21	G	A	5: 118,126,948 (GRCm39)	R233H	probably damaging	Het
Firrm	T	C	1: 163,805,656 (GRCm39)	Y316C	probably damaging	Het
Gm6526	A	G	14: 43,986,331 (GRCm39)	I86V	probably damaging	Het
Gpr107	T	A	2: 31,042,384 (GRCm39)	V5E	probably benign	Het
Hat1	A	T	2: 71,240,585 (GRCm39)	D93V	probably benign	Het
Kctd21	T	A	7: 96,996,614 (GRCm39)	L29Q	probably damaging	Het
Kl	C	G	5: 150,876,466 (GRCm39)	F95L	probably damaging	Het
Lsamp	A	G	16: 41,954,788 (GRCm39)	K229E	probably benign	Het
Mcm5	A	G	8: 75,840,825 (GRCm39)	D210G	probably damaging	Het
Mdn1	T	C	4: 32,689,581 (GRCm39)	V930A	possibly damaging	Het
Megf6	T	A	4: 154,347,056 (GRCm39)	C652*	probably null	Het
Nae1	A	T	8: 105,251,001 (GRCm39)	L196H	possibly damaging	Het
Ncor1	G	T	11: 62,208,675 (GRCm39)	D156E	probably damaging	Het
Nop14	A	T	5: 34,817,235 (GRCm39)	V52E	probably damaging	Het
Nova2	G	A	7: 18,691,794 (GRCm39)	A244T	unknown	Het
Parp14	A	T	16: 35,677,389 (GRCm39)	C860S	probably damaging	Het
Ptpn4	T	C	1: 119,692,866 (GRCm39)	Y161C	probably damaging	Het
Ptpn9	T	A	9: 56,968,430 (GRCm39)	M590K	probably benign	Het
Ptprq	A	G	10: 107,361,621 (GRCm39)	I2130T	probably damaging	Het
Pudp	C	A	18: 50,701,299 (GRCm39)	G145W	probably damaging	Het
Pxk	A	G	14: 8,150,964 (GRCm38)	K423R	probably benign	Het
Ryr1	A	G	7: 28,786,863 (GRCm39)	S1584P	probably damaging	Het
Scap	G	A	9: 110,207,845 (GRCm39)	R518H	probably damaging	Het
Slc5a12	T	C	2: 110,447,092 (GRCm39)	L200P	probably damaging	Het
Sntg1	T	A	1: 8,749,338 (GRCm39)	*72Y	probably null	Het
Speer4f1	A	C	5: 17,684,482 (GRCm39)	Q170P	possibly damaging	Het
Taar7d	A	C	10: 23,903,558 (GRCm39)	I147L	probably benign	Het
Tet2	T	C	3: 133,177,196 (GRCm39)	K1284E	possibly damaging	Het
Trpm2	A	C	10: 77,770,877 (GRCm39)		probably null	Het
Washc2	T	A	6: 116,204,327 (GRCm39)	S412T	probably benign	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79,296,234 (GRCm39)	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79,327,674 (GRCm39)	missense	probably benign
IGL01148:Zfyve26	APN	12	79,307,644 (GRCm39)	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79,298,957 (GRCm39)	splice site	probably null
IGL01472:Zfyve26	APN	12	79,323,117 (GRCm39)	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79,291,147 (GRCm39)	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79,334,625 (GRCm39)	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79,308,348 (GRCm39)	splice site	probably null
IGL01689:Zfyve26	APN	12	79,330,827 (GRCm39)	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79,334,218 (GRCm39)	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79,291,174 (GRCm39)	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79,323,169 (GRCm39)	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79,315,621 (GRCm39)	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79,326,854 (GRCm39)	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79,285,794 (GRCm39)	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79,310,644 (GRCm39)	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79,308,565 (GRCm39)	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79,342,338 (GRCm39)	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79,330,846 (GRCm39)	nonsense	probably null
challenge	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
fourteener	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
IGL02799:Zfyve26	UTSW	12	79,320,084 (GRCm39)	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79,323,055 (GRCm39)	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79,291,258 (GRCm39)	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79,292,996 (GRCm39)	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79,315,502 (GRCm39)	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79,312,576 (GRCm39)	splice site	probably benign
R0738:Zfyve26	UTSW	12	79,342,308 (GRCm39)	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79,320,372 (GRCm39)	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79,318,901 (GRCm39)	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79,310,723 (GRCm39)	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79,321,694 (GRCm39)	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79,329,591 (GRCm39)	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79,298,937 (GRCm39)	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79,298,925 (GRCm39)	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79,334,535 (GRCm39)	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79,285,718 (GRCm39)	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79,325,237 (GRCm39)	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79,315,823 (GRCm39)	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79,333,032 (GRCm39)	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79,311,125 (GRCm39)	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79,286,744 (GRCm39)	nonsense	probably null
R1982:Zfyve26	UTSW	12	79,302,017 (GRCm39)	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79,330,806 (GRCm39)	splice site	probably null
R2071:Zfyve26	UTSW	12	79,334,220 (GRCm39)	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79,292,826 (GRCm39)	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79,292,861 (GRCm39)	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79,321,814 (GRCm39)	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79,330,890 (GRCm39)	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79,329,573 (GRCm39)	splice site	probably null
R3084:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R3086:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R4626:Zfyve26	UTSW	12	79,315,844 (GRCm39)	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79,291,170 (GRCm39)	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79,296,469 (GRCm39)	splice site	probably null
R4926:Zfyve26	UTSW	12	79,321,785 (GRCm39)	missense	probably benign
R4990:Zfyve26	UTSW	12	79,334,607 (GRCm39)	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79,327,159 (GRCm39)	nonsense	probably null
R5029:Zfyve26	UTSW	12	79,333,097 (GRCm39)	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79,302,135 (GRCm39)	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79,326,832 (GRCm39)	nonsense	probably null
R5252:Zfyve26	UTSW	12	79,315,756 (GRCm39)	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79,317,624 (GRCm39)	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79,293,295 (GRCm39)	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79,286,698 (GRCm39)	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79,320,147 (GRCm39)	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79,311,131 (GRCm39)	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79,334,511 (GRCm39)	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79,313,311 (GRCm39)	missense	probably benign	0.30
R6184:Zfyve26	UTSW	12	79,315,501 (GRCm39)	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79,296,373 (GRCm39)	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79,286,776 (GRCm39)	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79,285,109 (GRCm39)	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79,313,223 (GRCm39)	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79,330,926 (GRCm39)	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79,325,888 (GRCm39)	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79,327,179 (GRCm39)	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79,315,182 (GRCm39)	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79,292,945 (GRCm39)	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79,325,146 (GRCm39)	splice site	probably null
R7299:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79,297,942 (GRCm39)	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79,286,828 (GRCm39)	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79,334,581 (GRCm39)	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79,315,450 (GRCm39)	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79,337,731 (GRCm39)	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79,315,409 (GRCm39)	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79,327,129 (GRCm39)	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79,302,098 (GRCm39)	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79,315,331 (GRCm39)	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79,327,610 (GRCm39)	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79,307,605 (GRCm39)	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79,334,454 (GRCm39)	missense	probably damaging	0.99
R8686:Zfyve26	UTSW	12	79,334,227 (GRCm39)	missense	probably benign
R8758:Zfyve26	UTSW	12	79,311,083 (GRCm39)	critical splice donor site	probably benign
R8826:Zfyve26	UTSW	12	79,285,742 (GRCm39)	missense	probably benign	0.05
R8877:Zfyve26	UTSW	12	79,334,152 (GRCm39)	missense	probably benign	0.05
R9067:Zfyve26	UTSW	12	79,318,915 (GRCm39)	missense	probably damaging	0.99
R9195:Zfyve26	UTSW	12	79,311,168 (GRCm39)	missense	probably benign	0.12
R9269:Zfyve26	UTSW	12	79,323,076 (GRCm39)	missense	possibly damaging	0.73
R9273:Zfyve26	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
R9340:Zfyve26	UTSW	12	79,321,680 (GRCm39)	nonsense	probably null
R9348:Zfyve26	UTSW	12	79,315,231 (GRCm39)	missense	possibly damaging	0.81
R9482:Zfyve26	UTSW	12	79,291,239 (GRCm39)	missense	probably damaging	1.00
R9536:Zfyve26	UTSW	12	79,298,046 (GRCm39)	missense	probably benign	0.32
R9653:Zfyve26	UTSW	12	79,334,418 (GRCm39)	missense	probably benign
R9676:Zfyve26	UTSW	12	79,330,959 (GRCm39)	missense	probably benign	0.01
R9797:Zfyve26	UTSW	12	79,293,006 (GRCm39)	missense	probably damaging	0.98
RF010:Zfyve26	UTSW	12	79,302,112 (GRCm39)	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79,285,779 (GRCm39)	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79,315,307 (GRCm39)	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79,334,149 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGACAGCATCACTCCAAATG -3'
(R):5'- CCAGTTCAGCTCTAAAGTGGGC -3'

Posted On

2017-07-14