Incidental Mutation 'R6076:Hspa14'
ID482725
Institutional Source Beutler Lab
Gene Symbol Hspa14
Ensembl Gene ENSMUSG00000109865
Gene Nameheat shock protein 14
SynonymsHsp70-4, 70kDa, NST-1, HSP70L1
MMRRC Submission 044237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6076 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location3488850-3512814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3511072 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 55 (S55N)
Ref Sequence ENSEMBL: ENSMUSP00000027961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027961] [ENSMUST00000036350] [ENSMUST00000124331] [ENSMUST00000140494]
Predicted Effect probably benign
Transcript: ENSMUST00000027961
AA Change: S55N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027961
Gene: ENSMUSG00000109865
AA Change: S55N

DomainStartEndE-ValueType
Pfam:HSP70 3 509 6.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036350
SMART Domains Protein: ENSMUSP00000046297
Gene: ENSMUSG00000039496

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Armet 36 181 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124331
SMART Domains Protein: ENSMUSP00000119850
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 74 1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132566
Predicted Effect probably benign
Transcript: ENSMUST00000140494
SMART Domains Protein: ENSMUSP00000120385
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 88 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148167
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp6v0a1 T A 11: 101,055,060 I723N probably damaging Het
C530025M09Rik T C 2: 149,830,750 probably benign Het
Cdkn1a A G 17: 29,099,358 K149E probably damaging Het
Cep70 T A 9: 99,298,505 I571N probably damaging Het
Col9a1 A T 1: 24,195,376 probably benign Het
Csde1 G A 3: 103,041,229 D132N possibly damaging Het
Dlk1 A G 12: 109,459,969 Q256R probably damaging Het
Epha6 A T 16: 60,205,710 D456E probably damaging Het
Ephx2 A G 14: 66,092,848 V354A probably damaging Het
Fpr-rs4 A G 17: 18,022,055 N108S probably damaging Het
Gimap1 C T 6: 48,742,587 Q116* probably null Het
Gm10784 T C 13: 49,945,274 noncoding transcript Het
Grid2ip G C 5: 143,387,375 S736T probably benign Het
Hic1 T C 11: 75,167,328 D245G probably damaging Het
Hpcal4 C A 4: 123,190,721 Q148K probably benign Het
Hspa1b G A 17: 34,957,497 T504I probably damaging Het
Jchain G T 5: 88,527,772 T3N probably benign Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Kndc1 A G 7: 139,902,038 T115A probably damaging Het
Lrp8 G T 4: 107,847,459 R292L possibly damaging Het
Lrrc15 T A 16: 30,272,988 D511V probably benign Het
Mapk8 A G 14: 33,390,293 C213R probably damaging Het
Mcph1 C T 8: 18,631,999 P384L probably benign Het
Mrps7 T C 11: 115,604,887 S84P probably damaging Het
Nceh1 A C 3: 27,279,195 I147L probably benign Het
Noxa1 A T 2: 25,085,809 I409N probably damaging Het
Olfr406 T C 11: 74,270,262 I291T probably damaging Het
Pkd1 G A 17: 24,581,030 G2975R probably benign Het
Ppip5k1 T C 2: 121,337,110 D17G probably null Het
Prex2 T A 1: 11,185,950 Y1182N probably benign Het
Rasa2 T C 9: 96,545,646 N722S probably benign Het
Rcc1l A G 5: 134,169,328 V155A possibly damaging Het
Rest A G 5: 77,282,974 E1080G unknown Het
Sacs A T 14: 61,204,536 K1344* probably null Het
Sec16a C T 2: 26,423,942 E1884K probably damaging Het
Secisbp2 C A 13: 51,679,777 T651K probably damaging Het
Sema3e A G 5: 14,241,086 D620G probably benign Het
Slc6a17 A G 3: 107,472,071 S553P possibly damaging Het
Smpd5 C A 15: 76,294,892 N153K probably damaging Het
Tex33 T C 15: 78,386,227 R114G possibly damaging Het
Ube2d4 T A 15: 58,847,143 noncoding transcript Het
Vps13c A G 9: 67,911,602 I1102V probably damaging Het
Wdr36 C A 18: 32,846,945 S241Y probably damaging Het
Wdr7 T A 18: 63,739,277 D427E probably damaging Het
Zfp945 G A 17: 22,851,458 P489L probably damaging Het
Other mutations in Hspa14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hspa14 APN 2 3502759 missense probably damaging 1.00
IGL02293:Hspa14 APN 2 3511034 missense probably damaging 1.00
IGL02477:Hspa14 APN 2 3496624 missense probably damaging 0.98
IGL02711:Hspa14 APN 2 3502520 missense probably benign 0.15
R0522:Hspa14 UTSW 2 3511049 missense probably damaging 1.00
R1169:Hspa14 UTSW 2 3498124 missense possibly damaging 0.90
R1426:Hspa14 UTSW 2 3508821 missense probably damaging 1.00
R1471:Hspa14 UTSW 2 3491608 missense probably benign 0.01
R1846:Hspa14 UTSW 2 3491660 missense possibly damaging 0.50
R1971:Hspa14 UTSW 2 3489767 missense possibly damaging 0.51
R2353:Hspa14 UTSW 2 3511176 splice site probably null
R3508:Hspa14 UTSW 2 3491008 missense probably damaging 1.00
R3859:Hspa14 UTSW 2 3494579 nonsense probably null
R4012:Hspa14 UTSW 2 3512638 missense probably damaging 0.99
R4360:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R4938:Hspa14 UTSW 2 3491609 missense probably benign 0.01
R5028:Hspa14 UTSW 2 3498169 missense possibly damaging 0.72
R5326:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5542:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5881:Hspa14 UTSW 2 3498170 missense probably benign 0.34
R6046:Hspa14 UTSW 2 3489764 missense possibly damaging 0.91
R6112:Hspa14 UTSW 2 3498068 missense probably benign
R6334:Hspa14 UTSW 2 3489072 unclassified probably null
R7297:Hspa14 UTSW 2 3498142 missense possibly damaging 0.76
R7424:Hspa14 UTSW 2 3489041 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAACCGCCATTAAACAGTCTGG -3'
(R):5'- TGTGCATTCCAGTGTGAGAG -3'

Sequencing Primer
(F):5'- CGCCATTAAACAGTCTGGAGTGTC -3'
(R):5'- TGCATTCCAGTGTGAGAGAACTAACC -3'
Posted On2017-07-14