Mutagenetix > Incidental Mutation

Incidental Mutation 'R6076:Mrps7'

482751

Institutional Source

Beutler Lab

Gene Symbol

Mrps7

Ensembl Gene

ENSMUSG00000046756

Gene Name

mitchondrial ribosomal protein S7

Synonyms

MRP-S7, Rpms7

MMRRC Submission

044237-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R6076 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

115494966-115498862 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115495713 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 84 (S84P)

Ref Sequence

ENSEMBL: ENSMUSP00000053033 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021087] [ENSMUST00000058109] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000106508] [ENSMUST00000156173] [ENSMUST00000148574] [ENSMUST00000125097]

AlphaFold

Q80X85

Predicted Effect

probably benign
Transcript: ENSMUST00000019135

SMART Domains

Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740

Domain	Start	End	E-Value	Type
VHS	9	142	9.36e-55	SMART
low complexity region	174	185	N/A	INTRINSIC
Pfam:GAT	222	299	1.7e-20	PFAM
low complexity region	334	369	N/A	INTRINSIC
low complexity region	383	395	N/A	INTRINSIC
low complexity region	455	471	N/A	INTRINSIC
low complexity region	483	498	N/A	INTRINSIC
low complexity region	532	554	N/A	INTRINSIC
Alpha_adaptinC2	586	710	6.09e-43	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000021087

SMART Domains

Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743

Domain	Start	End	E-Value	Type
Pfam:MIF4G	4	205	1.4e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000058109
AA Change: S84P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000053033
Gene: ENSMUSG00000046756
AA Change: S84P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Ribosomal_S7	68	234	7.1e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106506

SMART Domains

Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743

Domain	Start	End	E-Value	Type
Pfam:MIF4G	4	186	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106507

SMART Domains

Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743

Domain	Start	End	E-Value	Type
Pfam:MIF4G	4	204	3.5e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106508

SMART Domains

Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740

Domain	Start	End	E-Value	Type
VHS	9	142	9.36e-55	SMART
low complexity region	174	185	N/A	INTRINSIC
Pfam:GAT	206	307	1.3e-32	PFAM
low complexity region	377	393	N/A	INTRINSIC
low complexity region	405	420	N/A	INTRINSIC
low complexity region	454	476	N/A	INTRINSIC
Alpha_adaptinC2	508	632	6.09e-43	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124407

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158851

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137304

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148782

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149814

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146244

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142637

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132503

Predicted Effect

probably benign
Transcript: ENSMUST00000156173

SMART Domains

Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

Domain	Start	End	E-Value	Type
VHS	9	142	9.36e-55	SMART
low complexity region	174	185	N/A	INTRINSIC
Pfam:GAT	206	307	7.3e-32	PFAM
low complexity region	334	369	N/A	INTRINSIC
low complexity region	383	395	N/A	INTRINSIC
low complexity region	455	471	N/A	INTRINSIC
low complexity region	483	498	N/A	INTRINSIC
low complexity region	532	554	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148574

SMART Domains

Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

Domain	Start	End	E-Value	Type
Pfam:MIF4G	4	162	1.3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125097

SMART Domains

Protein: ENSMUSP00000118024
Gene: ENSMUSG00000020740

Domain	Start	End	E-Value	Type
Pfam:VHS	3	106	3.4e-41	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. In the prokaryotic ribosome, the comparable protein is thought to play an essential role in organizing the 3' domain of the 16 S rRNA in the vicinity of the P- and A-sites. Pseudogenes corresponding to this gene are found on chromosomes 8p and 12p. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank3	G	A	10: 69,838,395 (GRCm39)	R1566K	possibly damaging	Het
Atp6v0a1	T	A	11: 100,945,886 (GRCm39)	I723N	probably damaging	Het
C530025M09Rik	T	C	2: 149,672,670 (GRCm39)		probably benign	Het
Cdkn1a	A	G	17: 29,318,332 (GRCm39)	K149E	probably damaging	Het
Cep70	T	A	9: 99,180,558 (GRCm39)	I571N	probably damaging	Het
Cimip4	T	C	15: 78,270,427 (GRCm39)	R114G	possibly damaging	Het
Col9a1	A	T	1: 24,234,457 (GRCm39)		probably benign	Het
Csde1	G	A	3: 102,948,545 (GRCm39)	D132N	possibly damaging	Het
Dlk1	A	G	12: 109,425,895 (GRCm39)	Q256R	probably damaging	Het
Epha6	A	T	16: 60,026,073 (GRCm39)	D456E	probably damaging	Het
Ephx2	A	G	14: 66,330,297 (GRCm39)	V354A	probably damaging	Het
Fpr-rs4	A	G	17: 18,242,317 (GRCm39)	N108S	probably damaging	Het
Gimap1	C	T	6: 48,719,521 (GRCm39)	Q116*	probably null	Het
Gm10784	T	C	13: 50,099,310 (GRCm39)		noncoding transcript	Het
Grid2ip	G	C	5: 143,373,130 (GRCm39)	S736T	probably benign	Het
Hic1	T	C	11: 75,058,154 (GRCm39)	D245G	probably damaging	Het
Hpcal4	C	A	4: 123,084,514 (GRCm39)	Q148K	probably benign	Het
Hspa14	C	T	2: 3,512,109 (GRCm39)	S55N	probably benign	Het
Hspa1b	G	A	17: 35,176,473 (GRCm39)	T504I	probably damaging	Het
Jchain	G	T	5: 88,675,631 (GRCm39)	T3N	probably benign	Het
Kl	C	G	5: 150,876,466 (GRCm39)	F95L	probably damaging	Het
Kndc1	A	G	7: 139,481,954 (GRCm39)	T115A	probably damaging	Het
Lrp8	G	T	4: 107,704,656 (GRCm39)	R292L	possibly damaging	Het
Lrrc15	T	A	16: 30,091,806 (GRCm39)	D511V	probably benign	Het
Mapk8	A	G	14: 33,112,250 (GRCm39)	C213R	probably damaging	Het
Mcph1	C	T	8: 18,682,015 (GRCm39)	P384L	probably benign	Het
Nceh1	A	C	3: 27,333,344 (GRCm39)	I147L	probably benign	Het
Noxa1	A	T	2: 24,975,821 (GRCm39)	I409N	probably damaging	Het
Or1p1c	T	C	11: 74,161,088 (GRCm39)	I291T	probably damaging	Het
Pkd1	G	A	17: 24,800,004 (GRCm39)	G2975R	probably benign	Het
Ppip5k1	T	C	2: 121,167,591 (GRCm39)	D17G	probably null	Het
Prex2	T	A	1: 11,256,174 (GRCm39)	Y1182N	probably benign	Het
Rasa2	T	C	9: 96,427,699 (GRCm39)	N722S	probably benign	Het
Rcc1l	A	G	5: 134,198,167 (GRCm39)	V155A	possibly damaging	Het
Rest	A	G	5: 77,430,821 (GRCm39)	E1080G	unknown	Het
Sacs	A	T	14: 61,441,985 (GRCm39)	K1344*	probably null	Het
Sec16a	C	T	2: 26,313,954 (GRCm39)	E1884K	probably damaging	Het
Secisbp2	C	A	13: 51,833,813 (GRCm39)	T651K	probably damaging	Het
Sema3e	A	G	5: 14,291,100 (GRCm39)	D620G	probably benign	Het
Slc6a17	A	G	3: 107,379,387 (GRCm39)	S553P	possibly damaging	Het
Smpd5	C	A	15: 76,179,092 (GRCm39)	N153K	probably damaging	Het
Ube2d4	T	A	15: 58,718,992 (GRCm39)		noncoding transcript	Het
Vps13c	A	G	9: 67,818,884 (GRCm39)	I1102V	probably damaging	Het
Wdr36	C	A	18: 32,979,998 (GRCm39)	S241Y	probably damaging	Het
Wdr7	T	A	18: 63,872,348 (GRCm39)	D427E	probably damaging	Het
Zfp945	G	A	17: 23,070,432 (GRCm39)	P489L	probably damaging	Het

Other mutations in Mrps7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Mrps7	APN	11	115,495,684 (GRCm39)	missense	possibly damaging	0.78
IGL02928:Mrps7	APN	11	115,495,910 (GRCm39)	nonsense	probably null
R1494:Mrps7	UTSW	11	115,494,952 (GRCm39)	unclassified	probably benign
R1501:Mrps7	UTSW	11	115,495,023 (GRCm39)	missense	probably benign	0.00
R1651:Mrps7	UTSW	11	115,495,581 (GRCm39)	nonsense	probably null
R1830:Mrps7	UTSW	11	115,497,811 (GRCm39)	missense	probably benign	0.01
R2895:Mrps7	UTSW	11	115,495,865 (GRCm39)	missense	probably benign	0.01
R5155:Mrps7	UTSW	11	115,495,655 (GRCm39)	nonsense	probably null
R6144:Mrps7	UTSW	11	115,495,000 (GRCm39)	missense	probably benign	0.43
R6180:Mrps7	UTSW	11	115,495,707 (GRCm39)	missense	possibly damaging	0.95
R7421:Mrps7	UTSW	11	115,495,717 (GRCm39)	missense	probably benign	0.22
R7541:Mrps7	UTSW	11	115,497,696 (GRCm39)	missense	probably damaging	0.97
R7697:Mrps7	UTSW	11	115,495,701 (GRCm39)	missense	probably benign	0.00
R7981:Mrps7	UTSW	11	115,497,687 (GRCm39)	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GAGTCACAGATTCACCCGTAG -3'
(R):5'- GCCAGAACTTTGTTGCCTC -3'

Sequencing Primer
(F):5'- CGTAGGGTTCTGTCTGCTTCC -3'
(R):5'- TCCCTTCATCATCATGTTGGTG -3'

Posted On

2017-07-14