Incidental Mutation 'R0518:Bank1'
ID48278
Institutional Source Beutler Lab
Gene Symbol Bank1
Ensembl Gene ENSMUSG00000037922
Gene NameB cell scaffold protein with ankyrin repeats 1
SynonymsA530094C12Rik
MMRRC Submission 038711-MU
Accession Numbers

Genbank: NM_001033350.2

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0518 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location136053363-136326066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136213942 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 364 (C364Y)
Ref Sequence ENSEMBL: ENSMUSP00000035484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041577] [ENSMUST00000196159] [ENSMUST00000198206]
Predicted Effect probably damaging
Transcript: ENSMUST00000041577
AA Change: C364Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035484
Gene: ENSMUSG00000037922
AA Change: C364Y

DomainStartEndE-ValueType
DBB 197 327 1.24e-62 SMART
Blast:ANK 341 371 7e-12 BLAST
SCOP:d1awcb_ 344 398 2e-4 SMART
Blast:ANK 377 407 2e-6 BLAST
coiled coil region 465 486 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
coiled coil region 560 583 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196159
AA Change: C231Y

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142366
Gene: ENSMUSG00000037922
AA Change: C231Y

DomainStartEndE-ValueType
DBB 64 194 1.24e-62 SMART
Blast:ANK 208 238 6e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 3e-6 BLAST
coiled coil region 332 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 427 450 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198034
Predicted Effect possibly damaging
Transcript: ENSMUST00000198206
AA Change: C231Y

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142996
Gene: ENSMUSG00000037922
AA Change: C231Y

DomainStartEndE-ValueType
DBB 64 194 5.9e-67 SMART
Blast:ANK 208 238 5e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 2e-6 BLAST
low complexity region 300 313 N/A INTRINSIC
coiled coil region 359 382 N/A INTRINSIC
low complexity region 408 421 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased germinal center formation and IgM production in response to T-dependent antigens, and show enhanced CD40-mediated B cell proliferative and survival responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Acaca A G 11: 84,290,286 probably null Het
Acsm5 T C 7: 119,535,800 V327A possibly damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Akr1c14 T C 13: 4,081,016 L236S probably damaging Het
Ammecr1l C T 18: 31,771,901 S65L probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Arhgef16 G T 4: 154,291,034 P168T probably damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Cacna1s C A 1: 136,076,859 D132E probably benign Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Coa3 T A 11: 101,278,890 K13M probably damaging Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crhbp C A 13: 95,443,895 probably null Het
Cryba2 T C 1: 74,890,125 Y153C possibly damaging Het
Cryzl2 T C 1: 157,464,430 V93A probably damaging Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Cyp2r1 T G 7: 114,552,900 H274P probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx58 C T 4: 40,216,354 probably null Het
Dnd1 A G 18: 36,764,043 V350A possibly damaging Het
Dsg1b A T 18: 20,388,164 Q26L probably benign Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Fam20b C A 1: 156,687,456 V280F possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hk3 C T 13: 55,014,426 probably null Het
Hsd3b7 A G 7: 127,803,079 T330A probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Kti12 T A 4: 108,848,579 V230E possibly damaging Het
Mgat5 T A 1: 127,384,847 I241N probably damaging Het
Mkln1 A G 6: 31,468,132 N321S probably benign Het
Mllt10 T G 2: 18,071,206 probably null Het
Ms4a1 C A 19: 11,258,679 probably null Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nipsnap3b T A 4: 53,021,343 F243I probably damaging Het
Ogfod1 T A 8: 94,055,248 probably null Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
P2ry14 T A 3: 59,115,204 E287D probably damaging Het
Pank4 A T 4: 154,976,625 R510S possibly damaging Het
Pcsk6 T A 7: 65,980,167 V347E possibly damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pik3c2b C A 1: 133,105,992 P1578H probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
Ppp1r26 A G 2: 28,452,302 D648G probably damaging Het
Ptprs A G 17: 56,419,621 probably null Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Ski A G 4: 155,159,286 probably null Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Slc25a36 A T 9: 97,097,175 I71N probably damaging Het
Syne2 A C 12: 76,108,862 probably null Het
Tdrd5 C A 1: 156,262,941 W845L probably damaging Het
Tfb2m T C 1: 179,537,824 I192V possibly damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tmem211 T A 5: 113,236,007 L97* probably null Het
Trank1 A C 9: 111,333,808 D45A probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Trim9 A T 12: 70,346,585 L195Q probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn1r4 G T 6: 56,956,898 C129F probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Wdr78 A C 4: 103,064,530 Y464* probably null Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Bank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Bank1 APN 3 136247634 missense probably damaging 0.99
IGL03088:Bank1 APN 3 136093362 missense probably damaging 0.98
IGL03190:Bank1 APN 3 136100424 missense probably damaging 1.00
I2289:Bank1 UTSW 3 136054418 missense probably damaging 1.00
PIT4504001:Bank1 UTSW 3 136100419 missense probably damaging 1.00
R0193:Bank1 UTSW 3 136066518 splice site probably benign
R0423:Bank1 UTSW 3 136284017 missense possibly damaging 0.68
R0521:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0587:Bank1 UTSW 3 136214037 splice site probably benign
R0628:Bank1 UTSW 3 136066390 missense probably damaging 1.00
R0723:Bank1 UTSW 3 136054403 splice site probably null
R0811:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R0812:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R1101:Bank1 UTSW 3 136283864 missense probably benign 0.08
R1446:Bank1 UTSW 3 136064143 missense probably damaging 1.00
R1564:Bank1 UTSW 3 136213841 nonsense probably null
R1636:Bank1 UTSW 3 136083226 missense probably damaging 1.00
R1667:Bank1 UTSW 3 136093296 missense probably damaging 1.00
R1751:Bank1 UTSW 3 136234614 missense probably benign 0.00
R1751:Bank1 UTSW 3 136254937 missense probably benign 0.00
R2023:Bank1 UTSW 3 136325918 missense probably benign 0.02
R2851:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R2852:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R3411:Bank1 UTSW 3 136247773 splice site probably benign
R4422:Bank1 UTSW 3 136083211 missense probably damaging 0.99
R4499:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4693:Bank1 UTSW 3 136247676 missense probably damaging 0.99
R4744:Bank1 UTSW 3 136247689 missense probably benign 0.12
R4791:Bank1 UTSW 3 136254929 missense probably benign 0.00
R4911:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4967:Bank1 UTSW 3 136066373 missense probably damaging 1.00
R4979:Bank1 UTSW 3 136254901 missense probably damaging 0.99
R5119:Bank1 UTSW 3 136234682 missense possibly damaging 0.67
R5284:Bank1 UTSW 3 136064154 missense probably damaging 1.00
R5547:Bank1 UTSW 3 136066349 missense probably damaging 0.99
R5610:Bank1 UTSW 3 136066387 missense probably damaging 1.00
R6012:Bank1 UTSW 3 136213837 missense probably benign 0.44
R6087:Bank1 UTSW 3 136066429 missense probably damaging 1.00
R6753:Bank1 UTSW 3 136093308 missense probably damaging 1.00
R6764:Bank1 UTSW 3 136242940 missense probably damaging 0.97
R6861:Bank1 UTSW 3 136255003 missense probably benign 0.33
R7013:Bank1 UTSW 3 136100509 missense possibly damaging 0.74
R7436:Bank1 UTSW 3 136055800 missense possibly damaging 0.76
V1662:Bank1 UTSW 3 136054418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTACGTGCTTGGTCACACATAG -3'
(R):5'- GAGTCTGCATTGCAACAGCCAC -3'

Sequencing Primer
(F):5'- GTGGAAAGTACCTTAGCCTCATCAG -3'
(R):5'- GTATTTACTGAAGTTCTGCTCAGC -3'
Posted On2013-06-12