Incidental Mutation 'R6077:Cdh17'
ID482781
Institutional Source Beutler Lab
Gene Symbol Cdh17
Ensembl Gene ENSMUSG00000028217
Gene Namecadherin 17
SynonymsBILL-cadherin, LI-cadherin, HPT-1
MMRRC Submission 044238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6077 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location11758147-11817895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11803969 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 547 (S547R)
Ref Sequence ENSEMBL: ENSMUSP00000103938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029871] [ENSMUST00000108303]
Predicted Effect probably benign
Transcript: ENSMUST00000029871
AA Change: S547R

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: S547R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Blast:CA 687 771 5e-39 BLAST
transmembrane domain 784 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108303
AA Change: S547R

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103938
Gene: ENSMUSG00000028217
AA Change: S547R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C T 11: 100,519,757 V132I probably benign Het
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Adgre5 A G 8: 83,727,966 S301P probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh1b1 A G 4: 45,802,525 Y21C possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Itih1 A T 14: 30,929,876 F840L possibly damaging Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Lrrd1 A G 5: 3,850,837 I381V probably benign Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Olfr263 A T 13: 21,133,293 I173F probably benign Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Scn7a T A 2: 66,697,596 N850I probably damaging Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Cdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Cdh17 APN 4 11797780 splice site probably benign
IGL00823:Cdh17 APN 4 11783412 missense possibly damaging 0.78
IGL00824:Cdh17 APN 4 11784675 missense probably benign 0.00
IGL01572:Cdh17 APN 4 11784621 splice site probably benign
IGL01602:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01605:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01759:Cdh17 APN 4 11771262 splice site probably benign
IGL02065:Cdh17 APN 4 11771373 splice site probably benign
IGL02448:Cdh17 APN 4 11784680 missense probably benign
IGL02869:Cdh17 APN 4 11814908 missense probably benign 0.00
IGL03088:Cdh17 APN 4 11810473 missense probably damaging 1.00
Disruptive UTSW 4 11784654 missense probably damaging 1.00
R0054:Cdh17 UTSW 4 11785186 missense possibly damaging 0.59
R0081:Cdh17 UTSW 4 11785280 splice site probably benign
R0101:Cdh17 UTSW 4 11771341 missense probably benign 0.00
R0432:Cdh17 UTSW 4 11771273 nonsense probably null
R0718:Cdh17 UTSW 4 11810451 missense possibly damaging 0.68
R0946:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1076:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1217:Cdh17 UTSW 4 11799676 missense probably benign 0.04
R2060:Cdh17 UTSW 4 11803982 missense probably benign 0.03
R3808:Cdh17 UTSW 4 11795671 missense probably damaging 0.99
R3850:Cdh17 UTSW 4 11785201 missense probably damaging 1.00
R4111:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4112:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4583:Cdh17 UTSW 4 11810466 missense probably benign 0.00
R4683:Cdh17 UTSW 4 11817036 missense possibly damaging 0.78
R4797:Cdh17 UTSW 4 11810390 missense probably benign 0.00
R5050:Cdh17 UTSW 4 11784654 missense probably damaging 1.00
R5071:Cdh17 UTSW 4 11810325 missense probably damaging 0.98
R5569:Cdh17 UTSW 4 11816990 missense probably damaging 0.96
R5790:Cdh17 UTSW 4 11814945 unclassified probably null
R6581:Cdh17 UTSW 4 11799615 missense probably damaging 1.00
R7274:Cdh17 UTSW 4 11783174 nonsense probably null
X0067:Cdh17 UTSW 4 11785224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCACTTAATGCCCTGATGG -3'
(R):5'- ATGCAAGTAGGCCTGTCCAG -3'

Sequencing Primer
(F):5'- CCCTGATGGCACCTGAAATAAAGTTG -3'
(R):5'- AGCCCTGCTGCCCTGTAC -3'
Posted On2017-07-14