Incidental Mutation 'R6077:Lrrd1'
ID482783
Institutional Source Beutler Lab
Gene Symbol Lrrd1
Ensembl Gene ENSMUSG00000040367
Gene Nameleucine rich repeats and death domain containing 1
Synonyms4932412H11Rik
MMRRC Submission 044238-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R6077 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location3845173-3866596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3850837 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 381 (I381V)
Ref Sequence ENSEMBL: ENSMUSP00000038675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044039] [ENSMUST00000143027]
Predicted Effect probably benign
Transcript: ENSMUST00000044039
AA Change: I381V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000038675
Gene: ENSMUSG00000040367
AA Change: I381V

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
LRR 181 203 3.18e1 SMART
LRR 204 226 7.8e1 SMART
LRR 227 249 5.26e0 SMART
LRR 250 272 3.98e1 SMART
LRR 273 294 2.33e1 SMART
LRR 296 318 2.14e1 SMART
LRR_TYP 319 342 1.45e-2 SMART
LRR 365 388 4.44e0 SMART
LRR 389 410 2.76e1 SMART
LRR 411 433 8.73e1 SMART
LRR 434 457 3.55e1 SMART
LRR 480 503 1.45e1 SMART
LRR 526 548 1.31e0 SMART
LRR 549 571 3.65e1 SMART
LRR 572 594 6.22e0 SMART
LRR 595 618 2.68e1 SMART
LRR 644 665 1.15e1 SMART
LRR 667 689 8.01e0 SMART
LRR 690 713 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143027
SMART Domains Protein: ENSMUSP00000122668
Gene: ENSMUSG00000040367

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C T 11: 100,519,757 V132I probably benign Het
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Adgre5 A G 8: 83,727,966 S301P probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh1b1 A G 4: 45,802,525 Y21C possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdh17 T A 4: 11,803,969 S547R probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Itih1 A T 14: 30,929,876 F840L possibly damaging Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Olfr263 A T 13: 21,133,293 I173F probably benign Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Scn7a T A 2: 66,697,596 N850I probably damaging Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Lrrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Lrrd1 APN 5 3850573 missense possibly damaging 0.94
IGL00329:Lrrd1 APN 5 3850081 missense possibly damaging 0.94
IGL00674:Lrrd1 APN 5 3849773 missense possibly damaging 0.92
IGL00691:Lrrd1 APN 5 3863929 missense probably damaging 0.98
IGL00839:Lrrd1 APN 5 3850017 missense probably benign 0.00
IGL00911:Lrrd1 APN 5 3865689 missense probably benign 0.07
IGL01754:Lrrd1 APN 5 3851432 missense probably damaging 1.00
IGL01981:Lrrd1 APN 5 3851267 missense probably damaging 1.00
IGL02003:Lrrd1 APN 5 3849857 missense probably damaging 0.99
IGL02223:Lrrd1 APN 5 3850211 missense probably benign
IGL02477:Lrrd1 APN 5 3865770 missense probably benign
IGL02609:Lrrd1 APN 5 3858803 missense probably benign 0.26
IGL02833:Lrrd1 APN 5 3850709 missense probably damaging 0.98
IGL02886:Lrrd1 APN 5 3851534 missense probably benign 0.00
IGL02896:Lrrd1 APN 5 3851473 missense probably benign 0.08
R0045:Lrrd1 UTSW 5 3866418 missense possibly damaging 0.50
R0138:Lrrd1 UTSW 5 3851345 missense probably benign 0.04
R0305:Lrrd1 UTSW 5 3865707 missense probably damaging 1.00
R0346:Lrrd1 UTSW 5 3850215 missense probably benign 0.03
R0455:Lrrd1 UTSW 5 3866425 missense probably benign 0.21
R1717:Lrrd1 UTSW 5 3850580 missense probably damaging 0.99
R1719:Lrrd1 UTSW 5 3850483 unclassified probably null
R1836:Lrrd1 UTSW 5 3865709 missense probably benign 0.36
R1951:Lrrd1 UTSW 5 3851488 missense probably damaging 1.00
R2199:Lrrd1 UTSW 5 3866478 missense possibly damaging 0.86
R3751:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3752:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3837:Lrrd1 UTSW 5 3850204 missense possibly damaging 0.73
R3862:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3863:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3864:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R4816:Lrrd1 UTSW 5 3851126 nonsense probably null
R5225:Lrrd1 UTSW 5 3858735 missense probably benign 0.00
R5721:Lrrd1 UTSW 5 3850619 missense probably benign 0.13
R5791:Lrrd1 UTSW 5 3851254 missense probably benign 0.11
R6229:Lrrd1 UTSW 5 3863887 missense probably damaging 1.00
R6330:Lrrd1 UTSW 5 3850629 missense probably damaging 1.00
R6588:Lrrd1 UTSW 5 3851386 missense probably benign 0.19
R6734:Lrrd1 UTSW 5 3850226 missense possibly damaging 0.95
R6932:Lrrd1 UTSW 5 3851395 missense probably benign 0.06
R7180:Lrrd1 UTSW 5 3851459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGAAACATGATAGGCAGTTTG -3'
(R):5'- TTTGATTGCCTGAAAACTCCAG -3'

Sequencing Primer
(F):5'- GGAACTGAAAAATTTAGAAAGCCTTC -3'
(R):5'- TGAAAACTCCAGGATGTGTATATTAC -3'
Posted On2017-07-14