Incidental Mutation 'R6077:Acly'
ID482806
Institutional Source Beutler Lab
Gene Symbol Acly
Ensembl Gene ENSMUSG00000020917
Gene NameATP citrate lyase
SynonymsA730098H14Rik
MMRRC Submission 044238-MU
Accession Numbers

NCBI RefSeq: NM_001199296.1, NM_134037.3; MGI: 103251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6077 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100476353-100528000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100519757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 132 (V132I)
Ref Sequence ENSEMBL: ENSMUSP00000127632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000107385] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect probably benign
Transcript: ENSMUST00000007131
AA Change: V132I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917
AA Change: V132I

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107385
AA Change: V132I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103008
Gene: ENSMUSG00000020917
AA Change: V132I

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.1e-6 PFAM
SCOP:d1eucb1 255 417 1e-26 SMART
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107389
AA Change: V132I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917
AA Change: V132I

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165111
AA Change: V132I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917
AA Change: V132I

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 5287022; 3036686
Lethality: E7-E8
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic lethality. Heterozygous mutants display no obvious abnormalities. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI

All alleles(37) : Targeted(1) Gene trapped(35) Transgenic(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Adgre5 A G 8: 83,727,966 S301P probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh1b1 A G 4: 45,802,525 Y21C possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdh17 T A 4: 11,803,969 S547R probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Itih1 A T 14: 30,929,876 F840L possibly damaging Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Lrrd1 A G 5: 3,850,837 I381V probably benign Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Olfr263 A T 13: 21,133,293 I173F probably benign Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Scn7a T A 2: 66,697,596 N850I probably damaging Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Acly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Acly APN 11 100495910 missense probably benign 0.00
IGL01661:Acly APN 11 100514342 splice site probably benign
IGL02349:Acly APN 11 100519679 missense probably benign 0.01
IGL02792:Acly APN 11 100478410 missense probably damaging 0.97
IGL03026:Acly APN 11 100519690 missense possibly damaging 0.94
IGL03144:Acly APN 11 100515083 missense possibly damaging 0.84
IGL03230:Acly APN 11 100494059 missense probably damaging 0.99
IGL03266:Acly APN 11 100483752 missense probably damaging 1.00
coyote UTSW 11 100479255 missense probably damaging 0.99
lupine UTSW 11 100515905 missense probably damaging 1.00
P0014:Acly UTSW 11 100484604 missense probably benign 0.03
R0195:Acly UTSW 11 100512974 missense possibly damaging 0.56
R0319:Acly UTSW 11 100504982 missense probably damaging 1.00
R0598:Acly UTSW 11 100478390 missense probably damaging 1.00
R1115:Acly UTSW 11 100479255 missense probably damaging 0.99
R1201:Acly UTSW 11 100493935 missense probably damaging 1.00
R1498:Acly UTSW 11 100483801 missense probably benign 0.27
R1593:Acly UTSW 11 100481755 missense possibly damaging 0.74
R1804:Acly UTSW 11 100515905 missense probably damaging 1.00
R1817:Acly UTSW 11 100495891 missense probably benign 0.00
R1980:Acly UTSW 11 100495876 missense possibly damaging 0.87
R1997:Acly UTSW 11 100519151 missense probably damaging 1.00
R2125:Acly UTSW 11 100523496 missense probably benign 0.01
R3001:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3002:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3003:Acly UTSW 11 100504227 missense possibly damaging 0.91
R5194:Acly UTSW 11 100523546 missense probably benign
R5509:Acly UTSW 11 100514979 missense probably damaging 0.97
R5594:Acly UTSW 11 100522120 intron probably null
R6310:Acly UTSW 11 100482220 missense possibly damaging 0.92
R7099:Acly UTSW 11 100492291 intron probably null
R7148:Acly UTSW 11 100483782 missense possibly damaging 0.49
R7149:Acly UTSW 11 100484625 missense probably damaging 1.00
R7349:Acly UTSW 11 100521991 missense probably benign
X0028:Acly UTSW 11 100495933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCACACTGGACTTCTTGTC -3'
(R):5'- ACACAGATCTCCTTGGGGTG -3'

Sequencing Primer
(F):5'- GTCCCCATTTGTGCCCACG -3'
(R):5'- ACAGATCTCCTTGGGGTGAATGC -3'
Posted On2017-07-14