Incidental Mutation 'R6077:Olfr263'
ID482810
Institutional Source Beutler Lab
Gene Symbol Olfr263
Ensembl Gene ENSMUSG00000071522
Gene Nameolfactory receptor 263
SynonymsMOR256-61, GA_x6K02T2QHY8-12114828-12113875, Olfr263-ps1, Olfr42, MOR256-31, IA3, GA_x6K02T2N5E5-9379-8514, MOR256-37P
MMRRC Submission 044238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6077 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21129639-21136296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21133293 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 173 (I173F)
Ref Sequence ENSEMBL: ENSMUSP00000149892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096006] [ENSMUST00000215804]
Predicted Effect probably benign
Transcript: ENSMUST00000096006
AA Change: I173F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000093705
Gene: ENSMUSG00000071522
AA Change: I173F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-46 PFAM
Pfam:7tm_1 41 290 4.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215804
AA Change: I173F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C T 11: 100,519,757 V132I probably benign Het
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Adgre5 A G 8: 83,727,966 S301P probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh1b1 A G 4: 45,802,525 Y21C possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdh17 T A 4: 11,803,969 S547R probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Itih1 A T 14: 30,929,876 F840L possibly damaging Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Lrrd1 A G 5: 3,850,837 I381V probably benign Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Scn7a T A 2: 66,697,596 N850I probably damaging Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Olfr263
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1880:Olfr263 UTSW 13 21133632 missense probably damaging 1.00
R2012:Olfr263 UTSW 13 21133489 missense probably benign 0.13
R3113:Olfr263 UTSW 13 21133129 missense probably damaging 1.00
R4210:Olfr263 UTSW 13 21133437 missense possibly damaging 0.78
R4934:Olfr263 UTSW 13 21133071 missense probably benign
R4952:Olfr263 UTSW 13 21133344 missense probably benign 0.00
R5755:Olfr263 UTSW 13 21133525 missense probably damaging 0.98
R6012:Olfr263 UTSW 13 21132808 missense probably benign 0.01
R6168:Olfr263 UTSW 13 21133229 missense possibly damaging 0.53
R6325:Olfr263 UTSW 13 21133075 missense probably damaging 0.97
R6829:Olfr263 UTSW 13 21132853 missense possibly damaging 0.69
R7130:Olfr263 UTSW 13 21133246 missense probably benign 0.41
R7257:Olfr263 UTSW 13 21133257 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGTGTCTGCTCCTAGCTGTC -3'
(R):5'- TGAGATGGGATCCACAGGTATTC -3'

Sequencing Primer
(F):5'- AGCTGTCATGTCCTATGATCG -3'
(R):5'- AGATGGGATCCACAGGTATTCATTGC -3'
Posted On2017-07-14