Incidental Mutation 'R6078:Gm13103'
ID482827
Institutional Source Beutler Lab
Gene Symbol Gm13103
Ensembl Gene ENSMUSG00000029451
Gene Namepredicted gene 13103
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6078 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location143846497-143853637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 143851585 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 87 (H87Q)
Ref Sequence ENSEMBL: ENSMUSP00000123640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094522] [ENSMUST00000105768] [ENSMUST00000139747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094522
AA Change: H138Q

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092099
Gene: ENSMUSG00000029451
AA Change: H138Q

DomainStartEndE-ValueType
low complexity region 403 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105768
AA Change: H138Q

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000139747
AA Change: H87Q

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Abcc9 A G 6: 142,639,575 F801S probably damaging Het
Adam39 C T 8: 40,824,593 A7V probably benign Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Akap9 T C 5: 4,067,924 probably null Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cbfa2t3 T C 8: 122,643,497 H53R probably benign Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Insm2 T C 12: 55,600,014 I181T probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc4 T A 16: 32,755,247 probably benign Het
Nop14 T C 5: 34,657,951 D85G probably damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Vmn1r29 T C 6: 58,308,095 F267L probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zfp1 T C 8: 111,670,343 F299S probably damaging Het
Other mutations in Gm13103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Gm13103 APN 4 143853276 missense probably benign 0.01
IGL01383:Gm13103 APN 4 143846532 utr 5 prime probably benign
IGL01735:Gm13103 APN 4 143851831 missense probably damaging 1.00
IGL01976:Gm13103 APN 4 143852793 missense probably benign 0.17
IGL03096:Gm13103 APN 4 143850915 missense probably benign 0.01
IGL03280:Gm13103 APN 4 143851919 missense possibly damaging 0.74
IGL03295:Gm13103 APN 4 143853189 missense probably damaging 1.00
FR4342:Gm13103 UTSW 4 143851643 frame shift probably null
PIT4687001:Gm13103 UTSW 4 143846533 start gained probably benign
R0218:Gm13103 UTSW 4 143851831 missense probably damaging 1.00
R0612:Gm13103 UTSW 4 143852088 unclassified probably benign
R1755:Gm13103 UTSW 4 143850810 missense probably damaging 1.00
R2509:Gm13103 UTSW 4 143851991 missense probably benign 0.01
R2510:Gm13103 UTSW 4 143851991 missense probably benign 0.01
R2511:Gm13103 UTSW 4 143851991 missense probably benign 0.01
R4603:Gm13103 UTSW 4 143852881 missense probably benign 0.01
R4694:Gm13103 UTSW 4 143852960 missense probably damaging 0.97
R4856:Gm13103 UTSW 4 143853303 missense probably benign 0.00
R4886:Gm13103 UTSW 4 143853303 missense probably benign 0.00
R4927:Gm13103 UTSW 4 143851617 missense probably damaging 1.00
R5168:Gm13103 UTSW 4 143853198 missense probably benign 0.02
R5270:Gm13103 UTSW 4 143851898 missense probably damaging 0.97
R5402:Gm13103 UTSW 4 143851655 critical splice donor site probably null
R5618:Gm13103 UTSW 4 143850693 missense possibly damaging 0.92
R6138:Gm13103 UTSW 4 143851585 missense possibly damaging 0.58
R6362:Gm13103 UTSW 4 143852865 missense probably damaging 0.99
R6526:Gm13103 UTSW 4 143852814 missense probably damaging 1.00
R6555:Gm13103 UTSW 4 143851570 missense possibly damaging 0.58
R6595:Gm13103 UTSW 4 143852756 missense probably damaging 1.00
R6675:Gm13103 UTSW 4 143853258 missense probably damaging 0.98
U15987:Gm13103 UTSW 4 143851585 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CTAGAGGGTTGATTTTAGGCACAG -3'
(R):5'- AAGCTTTGAATTACCAGCTTCCTAC -3'

Sequencing Primer
(F):5'- TTGATTTTAGGCACAGGAAAAAGC -3'
(R):5'- CCAGCTTCCTACAGAATAGATGAATG -3'
Posted On2017-07-14