Incidental Mutation 'R6080:Smg5'
ID482878
Institutional Source Beutler Lab
Gene Symbol Smg5
Ensembl Gene ENSMUSG00000001415
Gene NameSmg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission 044239-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6080 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88336260-88362338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88351509 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 596 (T596A)
Ref Sequence ENSEMBL: ENSMUSP00000001451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451]
Predicted Effect probably benign
Transcript: ENSMUST00000001451
AA Change: T596A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415
AA Change: T596A

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193097
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 C T 14: 118,669,050 M44I possibly damaging Het
Anks1b C A 10: 90,966,349 S1209* probably null Het
Atp9b A G 18: 80,738,808 V1039A probably benign Het
Cep44 T C 8: 56,539,841 K246R possibly damaging Het
Cfap54 A T 10: 93,045,335 D330E possibly damaging Het
Dnah10 A T 5: 124,805,897 M2940L possibly damaging Het
Gm14326 T A 2: 177,936,546 T68S probably benign Het
Gm4922 A C 10: 18,784,752 I74S probably damaging Het
Ints14 G A 9: 64,966,762 V99I probably benign Het
Lrp4 T C 2: 91,502,000 S1681P probably benign Het
Lrp5 T C 19: 3,628,316 E513G probably benign Het
Myh14 T A 7: 44,655,611 N252I probably damaging Het
Naga A G 15: 82,334,847 V233A probably benign Het
Npc1 C T 18: 12,219,351 C97Y probably damaging Het
Olfr1309 T G 2: 111,983,705 Y123S probably damaging Het
Olfr1501 C A 19: 13,839,100 L24F possibly damaging Het
Olfr658 T C 7: 104,645,310 I19V probably benign Het
Olfr681 T C 7: 105,121,909 F151L probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Plag1 T C 4: 3,903,815 T459A probably benign Het
Rnase9 T C 14: 51,039,270 T84A probably benign Het
Rps6kb2 T A 19: 4,158,672 I282F probably benign Het
Ugcg T C 4: 59,218,524 V256A possibly damaging Het
Uhrf1bp1 T C 17: 27,880,297 S278P probably benign Het
Vgll4 T C 6: 114,921,338 I21V probably benign Het
Vipas39 T A 12: 87,241,953 H426L probably damaging Het
Vmn1r224 A G 17: 20,419,556 T132A possibly damaging Het
Zc3h18 A G 8: 122,416,544 probably benign Het
Zfp606 T A 7: 12,494,116 N663K probably damaging Het
Zfp819 A G 7: 43,616,696 H201R probably benign Het
Zfp946 T A 17: 22,455,109 H281Q probably benign Het
Other mutations in Smg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smg5 APN 3 88351428 nonsense probably null
IGL00902:Smg5 APN 3 88353085 missense probably benign 0.00
IGL00990:Smg5 APN 3 88343038 critical splice donor site probably null
IGL01371:Smg5 APN 3 88359644 unclassified probably benign
IGL01536:Smg5 APN 3 88349245 missense possibly damaging 0.58
IGL02215:Smg5 APN 3 88352998 missense possibly damaging 0.47
IGL03366:Smg5 APN 3 88346452 nonsense probably null
R0013:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0129:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0153:Smg5 UTSW 3 88353872 unclassified probably benign
R1386:Smg5 UTSW 3 88355671 missense probably damaging 1.00
R1941:Smg5 UTSW 3 88345380 missense possibly damaging 0.71
R2185:Smg5 UTSW 3 88351561 missense probably benign
R2282:Smg5 UTSW 3 88345398 missense probably benign 0.02
R3615:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R3616:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4008:Smg5 UTSW 3 88349158 missense probably benign 0.01
R4687:Smg5 UTSW 3 88342469 missense possibly damaging 0.83
R4726:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4801:Smg5 UTSW 3 88355692 nonsense probably null
R4802:Smg5 UTSW 3 88355692 nonsense probably null
R4977:Smg5 UTSW 3 88355725 nonsense probably null
R5384:Smg5 UTSW 3 88351293 missense probably damaging 1.00
R5443:Smg5 UTSW 3 88354589 missense probably damaging 0.99
R5779:Smg5 UTSW 3 88351618 unclassified probably benign
R5860:Smg5 UTSW 3 88342907 missense probably damaging 0.97
R6263:Smg5 UTSW 3 88341901 missense possibly damaging 0.90
R6431:Smg5 UTSW 3 88351220 missense probably benign 0.00
R6722:Smg5 UTSW 3 88353025 missense probably damaging 0.99
R6847:Smg5 UTSW 3 88342552 missense probably damaging 1.00
R6950:Smg5 UTSW 3 88349269 critical splice donor site probably null
R7091:Smg5 UTSW 3 88351347 missense probably benign 0.00
R7395:Smg5 UTSW 3 88361071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGGTCAGACCTGGAAGATATG -3'
(R):5'- TCTGGAGGCTGGAAATGAGTAC -3'

Sequencing Primer
(F):5'- GGACAAGATCTCCAGCCCAGG -3'
(R):5'- TACGTGCACAGGACAAGGATTCC -3'
Posted On2017-07-14