Incidental Mutation 'R6080:Npc1'
ID482902
Institutional Source Beutler Lab
Gene Symbol Npc1
Ensembl Gene ENSMUSG00000024413
Gene NameNPC intracellular cholesterol transporter 1
Synonymsnmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd
MMRRC Submission 044239-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R6080 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12189693-12236400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12219351 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 97 (C97Y)
Ref Sequence ENSEMBL: ENSMUSP00000025279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025279]
Predicted Effect probably damaging
Transcript: ENSMUST00000025279
AA Change: C97Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: C97Y

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149211
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 C T 14: 118,669,050 M44I possibly damaging Het
Anks1b C A 10: 90,966,349 S1209* probably null Het
Atp9b A G 18: 80,738,808 V1039A probably benign Het
Cep44 T C 8: 56,539,841 K246R possibly damaging Het
Cfap54 A T 10: 93,045,335 D330E possibly damaging Het
Dnah10 A T 5: 124,805,897 M2940L possibly damaging Het
Gm14326 T A 2: 177,936,546 T68S probably benign Het
Gm4922 A C 10: 18,784,752 I74S probably damaging Het
Ints14 G A 9: 64,966,762 V99I probably benign Het
Lrp4 T C 2: 91,502,000 S1681P probably benign Het
Lrp5 T C 19: 3,628,316 E513G probably benign Het
Myh14 T A 7: 44,655,611 N252I probably damaging Het
Naga A G 15: 82,334,847 V233A probably benign Het
Olfr1309 T G 2: 111,983,705 Y123S probably damaging Het
Olfr1501 C A 19: 13,839,100 L24F possibly damaging Het
Olfr658 T C 7: 104,645,310 I19V probably benign Het
Olfr681 T C 7: 105,121,909 F151L probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Plag1 T C 4: 3,903,815 T459A probably benign Het
Rnase9 T C 14: 51,039,270 T84A probably benign Het
Rps6kb2 T A 19: 4,158,672 I282F probably benign Het
Smg5 A G 3: 88,351,509 T596A probably benign Het
Ugcg T C 4: 59,218,524 V256A possibly damaging Het
Uhrf1bp1 T C 17: 27,880,297 S278P probably benign Het
Vgll4 T C 6: 114,921,338 I21V probably benign Het
Vipas39 T A 12: 87,241,953 H426L probably damaging Het
Vmn1r224 A G 17: 20,419,556 T132A possibly damaging Het
Zc3h18 A G 8: 122,416,544 probably benign Het
Zfp606 T A 7: 12,494,116 N663K probably damaging Het
Zfp819 A G 7: 43,616,696 H201R probably benign Het
Zfp946 T A 17: 22,455,109 H281Q probably benign Het
Other mutations in Npc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Npc1 APN 18 12199634 missense probably benign 0.45
IGL02523:Npc1 APN 18 12201572 missense probably benign 0.00
IGL03018:Npc1 APN 18 12214379 missense probably damaging 0.99
IGL03101:Npc1 APN 18 12198539 missense probably benign 0.15
IGL03151:Npc1 APN 18 12219275 missense probably benign 0.05
IGL03377:Npc1 APN 18 12211821 missense probably benign
PIT4354001:Npc1 UTSW 18 12211535 missense probably benign 0.00
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0190:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R0200:Npc1 UTSW 18 12219204 missense probably damaging 1.00
R0485:Npc1 UTSW 18 12213446 missense probably benign 0.00
R0699:Npc1 UTSW 18 12210575 missense probably benign 0.00
R0730:Npc1 UTSW 18 12219325 missense probably benign 0.00
R1302:Npc1 UTSW 18 12195085 missense probably benign 0.00
R1442:Npc1 UTSW 18 12195049 missense probably benign
R1463:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R1804:Npc1 UTSW 18 12223088 missense probably damaging 1.00
R1808:Npc1 UTSW 18 12194092 missense probably damaging 1.00
R1928:Npc1 UTSW 18 12213378 missense possibly damaging 0.79
R2112:Npc1 UTSW 18 12213472 missense possibly damaging 0.49
R2117:Npc1 UTSW 18 12196556 missense probably damaging 1.00
R2157:Npc1 UTSW 18 12191809 missense probably damaging 0.98
R2279:Npc1 UTSW 18 12197179 splice site probably null
R2311:Npc1 UTSW 18 12202183 missense probably benign
R2446:Npc1 UTSW 18 12214339 missense probably benign 0.01
R3004:Npc1 UTSW 18 12197254 missense probably benign 0.03
R4090:Npc1 UTSW 18 12198162 splice site probably null
R4304:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4308:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4564:Npc1 UTSW 18 12191732 missense probably damaging 1.00
R4786:Npc1 UTSW 18 12199497 missense probably benign 0.35
R5243:Npc1 UTSW 18 12198631 intron probably benign
R5404:Npc1 UTSW 18 12213299 missense possibly damaging 0.79
R5823:Npc1 UTSW 18 12191789 missense possibly damaging 0.69
R6215:Npc1 UTSW 18 12236192 small deletion probably benign
R6301:Npc1 UTSW 18 12197245 missense probably benign 0.00
R6476:Npc1 UTSW 18 12201694 nonsense probably null
R7007:Npc1 UTSW 18 12210548 missense probably benign 0.02
R7020:Npc1 UTSW 18 12198537 missense probably damaging 1.00
R7048:Npc1 UTSW 18 12204765 splice site probably null
R7116:Npc1 UTSW 18 12211544 missense probably damaging 1.00
R7153:Npc1 UTSW 18 12213291 missense possibly damaging 0.78
R7359:Npc1 UTSW 18 12195180 missense probably benign 0.05
R7382:Npc1 UTSW 18 12201706 missense probably damaging 0.99
X0012:Npc1 UTSW 18 12193311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CGAAGCTCTGTCCGACAAAG -3'
(R):5'- CCTATAGTGGTCTTTGTCACATGG -3'

Sequencing Primer
(F):5'- GCTCTGTCCGACAAAGTACTC -3'
(R):5'- AGGACCCGGGTTCAATTCTAAGTTC -3'
Posted On2017-07-14