Incidental Mutation 'R6081:4930556J24Rik'
ID482922
Institutional Source Beutler Lab
Gene Symbol 4930556J24Rik
Ensembl Gene ENSMUSG00000034493
Gene NameRIKEN cDNA 4930556J24 gene
Synonyms
MMRRC Submission 044240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6081 (G1)
Quality Score215.009
Status Not validated
Chromosome11
Chromosomal Location3937541-3976778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3938140 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 82 (Q82R)
Ref Sequence ENSEMBL: ENSMUSP00000048953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042344]
Predicted Effect unknown
Transcript: ENSMUST00000042344
AA Change: Q82R
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493
AA Change: Q82R

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in 4930556J24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:4930556J24Rik APN 11 3937974 missense unknown
P4717OSA:4930556J24Rik UTSW 11 3938178 splice site probably null
P4748:4930556J24Rik UTSW 11 3938178 splice site probably null
R0478:4930556J24Rik UTSW 11 3976259 intron probably benign
R5593:4930556J24Rik UTSW 11 3938027 missense unknown
R5594:4930556J24Rik UTSW 11 3938027 missense unknown
R5698:4930556J24Rik UTSW 11 3976366 missense possibly damaging 0.93
R6169:4930556J24Rik UTSW 11 3938005 missense unknown
R6626:4930556J24Rik UTSW 11 3938056 missense unknown
T0975:4930556J24Rik UTSW 11 3937945 frame shift probably null
T0975:4930556J24Rik UTSW 11 3976324 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTCTCTGGCCAAGAAGTGC -3'
(R):5'- ACATAGACATGCGTGCACAG -3'

Sequencing Primer
(F):5'- TCTGGCCAAGAAGTGCTCCAG -3'
(R):5'- TATTTACAGGGCAAGATGTGGTAGC -3'
Posted On2017-07-14