Incidental Mutation 'R6081:Otx1'
ID482923
Institutional Source Beutler Lab
Gene Symbol Otx1
Ensembl Gene ENSMUSG00000005917
Gene Nameorthodenticle homeobox 1
SynonymsA730044F23Rik, jv
MMRRC Submission 044240-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R6081 (G1)
Quality Score181.009
Status Not validated
Chromosome11
Chromosomal Location21994764-22002897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21999406 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 24 (L24H)
Ref Sequence ENSEMBL: ENSMUSP00000006071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]
Predicted Effect probably damaging
Transcript: ENSMUST00000006071
AA Change: L24H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: L24H

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
Pfam:TF_Otx 178 279 2.5e-39 PFAM
internal_repeat_1 310 322 1.39e-7 PROSPERO
low complexity region 324 331 N/A INTRINSIC
internal_repeat_1 334 346 1.39e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000147486
AA Change: L24H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917
AA Change: L24H

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172395
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Otx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Otx1 APN 11 21996794 unclassified probably benign
embarrassed UTSW 11 21997037 missense probably damaging 1.00
R1946:Otx1 UTSW 11 21998482 missense probably damaging 1.00
R2291:Otx1 UTSW 11 21996634 unclassified probably benign
R2870:Otx1 UTSW 11 21998681 intron probably benign
R4164:Otx1 UTSW 11 21996638 unclassified probably benign
R4845:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4925:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4934:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4993:Otx1 UTSW 11 21998532 splice site probably null
R5061:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5062:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5063:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5068:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5069:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5070:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5097:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5169:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5170:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5171:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5172:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5198:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5199:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5200:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5201:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5202:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5203:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5204:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5205:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5256:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5267:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5360:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5361:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5363:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5372:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5375:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5380:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5381:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5382:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5383:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5415:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5416:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5534:Otx1 UTSW 11 21996296 unclassified probably benign
R5592:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5594:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5725:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5727:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5735:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5736:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5841:Otx1 UTSW 11 21998594 intron probably benign
R5940:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5941:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6080:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6093:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6126:Otx1 UTSW 11 21996457 unclassified probably benign
R6131:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6132:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6134:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6187:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6220:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6269:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6270:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6271:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6272:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6396:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6619:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6624:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6680:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6681:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6718:Otx1 UTSW 11 21996412 unclassified probably benign
R6831:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6834:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6985:Otx1 UTSW 11 21996615 nonsense probably null
X0054:Otx1 UTSW 11 21996331 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTTCTACAGAGCAAGGCAAC -3'
(R):5'- GAAAGCCAAACTGACTGCGG -3'

Sequencing Primer
(F):5'- CAAGGCAACAGGCGGCG -3'
(R):5'- CCAAACTGACTGCGGGTGAAG -3'
Posted On2017-07-14