Mutagenetix > Incidental Mutation

Incidental Mutation 'R6081:Otx1'

482923

Institutional Source

Beutler Lab

Gene Symbol

Otx1

Ensembl Gene

ENSMUSG00000005917

Gene Name

orthodenticle homeobox 1

Synonyms

jv, A730044F23Rik

MMRRC Submission

044240-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.800) question?

Stock #

R6081 (G1)

Quality Score

181.009

Status

Not validated

Chromosome

Chromosomal Location

21944764-21952897 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21949406 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 24 (L24H)

Ref Sequence

ENSEMBL: ENSMUSP00000006071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]

AlphaFold

P80205

Predicted Effect

probably damaging
Transcript: ENSMUST00000006071
AA Change: L24H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: L24H

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
Pfam:TF_Otx	178	279	2.5e-39	PFAM
internal_repeat_1	310	322	1.39e-7	PROSPERO
low complexity region	324	331	N/A	INTRINSIC
internal_repeat_1	334	346	1.39e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000147486
AA Change: L24H

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917
AA Change: L24H

Domain	Start	End	E-Value	Type
HOX	38	100	1.21e-25	SMART
low complexity region	117	125	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172395

Meta Mutation Damage Score

0.2297

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,887,097 (GRCm39)	M33K	probably damaging	Het
4930556J24Rik	T	C	11: 3,888,140 (GRCm39)	Q82R	unknown	Het
Adcy9	T	C	16: 4,112,545 (GRCm39)	D714G	probably benign	Het
Afg3l2	G	T	18: 67,554,329 (GRCm39)	L458M	probably damaging	Het
Ahctf1	G	T	1: 179,609,237 (GRCm39)	A639E	probably benign	Het
Ank3	G	A	10: 69,838,395 (GRCm39)	R1566K	possibly damaging	Het
Anxa5	C	T	3: 36,519,436 (GRCm39)	D18N	probably damaging	Het
Apc	C	T	18: 34,423,164 (GRCm39)	P299L	possibly damaging	Het
Btnl4	C	A	17: 34,693,210 (GRCm39)	W68C	probably damaging	Het
Cmya5	T	A	13: 93,281,021 (GRCm39)		probably benign	Het
Cstf2t	G	T	19: 31,060,523 (GRCm39)	V20L	probably benign	Het
D630045J12Rik	A	T	6: 38,119,633 (GRCm39)	V1703E	probably damaging	Het
Dhx32	A	G	7: 133,323,941 (GRCm39)	F535S	probably damaging	Het
Diras2	T	C	13: 52,662,181 (GRCm39)	D42G	probably damaging	Het
Dppa3	T	A	6: 122,606,931 (GRCm39)	D140E	probably damaging	Het
Gpr180	C	T	14: 118,391,086 (GRCm39)	T205I	probably benign	Het
Gzme	T	G	14: 56,355,764 (GRCm39)	T183P	possibly damaging	Het
H2-T23	T	A	17: 36,342,707 (GRCm39)	I144F	possibly damaging	Het
Hlx	T	C	1: 184,459,894 (GRCm39)	S415G	probably benign	Het
Krtap5-3	G	A	7: 141,755,223 (GRCm39)	C20Y	unknown	Het
Mcm8	G	T	2: 132,670,003 (GRCm39)	R359L	probably benign	Het
Mroh2b	G	C	15: 4,973,859 (GRCm39)	E1126Q	probably damaging	Het
Nav1	C	T	1: 135,398,560 (GRCm39)	R674H	probably damaging	Het
Rnaset2b	T	A	17: 7,256,193 (GRCm39)		probably null	Het
Samd12	T	C	15: 53,583,074 (GRCm39)	K87E	probably benign	Het
Sec16b	T	C	1: 157,388,324 (GRCm39)	S564P	probably benign	Het
Speer4a1	A	T	5: 26,239,960 (GRCm39)	C263*	probably null	Het
Susd1	C	A	4: 59,411,359 (GRCm39)	C158F	possibly damaging	Het
Vmn2r6	C	T	3: 64,463,953 (GRCm39)	V294M	probably benign	Het

Other mutations in Otx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Otx1	APN	11	21,946,794 (GRCm39)	unclassified	probably benign
Embarrassed	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R1946:Otx1	UTSW	11	21,948,482 (GRCm39)	missense	probably damaging	1.00
R2291:Otx1	UTSW	11	21,946,634 (GRCm39)	unclassified	probably benign
R2870:Otx1	UTSW	11	21,948,681 (GRCm39)	intron	probably benign
R4164:Otx1	UTSW	11	21,946,638 (GRCm39)	unclassified	probably benign
R4845:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R4925:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R4934:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R4993:Otx1	UTSW	11	21,948,532 (GRCm39)	splice site	probably null
R5061:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5062:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5063:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5068:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5069:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5070:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5097:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5169:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5170:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5171:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5172:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5198:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5199:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5200:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5201:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5202:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5203:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5204:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5205:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5256:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5267:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5360:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5361:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5363:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5372:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5375:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5380:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5381:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5382:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5383:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5415:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5416:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5534:Otx1	UTSW	11	21,946,296 (GRCm39)	unclassified	probably benign
R5592:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5594:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5725:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5727:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5735:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5736:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5841:Otx1	UTSW	11	21,948,594 (GRCm39)	intron	probably benign
R5940:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R5941:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6080:Otx1	UTSW	11	21,949,406 (GRCm39)	missense	probably damaging	1.00
R6093:Otx1	UTSW	11	21,949,406 (GRCm39)	missense	probably damaging	1.00
R6126:Otx1	UTSW	11	21,946,457 (GRCm39)	unclassified	probably benign
R6131:Otx1	UTSW	11	21,949,406 (GRCm39)	missense	probably damaging	1.00
R6132:Otx1	UTSW	11	21,949,406 (GRCm39)	missense	probably damaging	1.00
R6134:Otx1	UTSW	11	21,949,406 (GRCm39)	missense	probably damaging	1.00
R6187:Otx1	UTSW	11	21,949,406 (GRCm39)	missense	probably damaging	1.00
R6220:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6269:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6270:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6271:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6272:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6396:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6619:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6624:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6680:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6681:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6718:Otx1	UTSW	11	21,946,412 (GRCm39)	unclassified	probably benign
R6831:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6834:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
R6985:Otx1	UTSW	11	21,946,615 (GRCm39)	nonsense	probably null
R7631:Otx1	UTSW	11	21,949,458 (GRCm39)	nonsense	probably null
R8100:Otx1	UTSW	11	21,949,392 (GRCm39)	missense	probably benign	0.16
R9125:Otx1	UTSW	11	21,949,458 (GRCm39)	nonsense	probably null
R9541:Otx1	UTSW	11	21,947,052 (GRCm39)	missense	probably damaging	1.00
X0054:Otx1	UTSW	11	21,946,331 (GRCm39)	unclassified	probably benign
Z1187:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00
Z1192:Otx1	UTSW	11	21,947,037 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTCTACAGAGCAAGGCAAC -3'
(R):5'- GAAAGCCAAACTGACTGCGG -3'

Sequencing Primer
(F):5'- CAAGGCAACAGGCGGCG -3'
(R):5'- CCAAACTGACTGCGGGTGAAG -3'

Posted On

2017-07-14