Incidental Mutation 'R6081:Adcy9'
ID482930
Institutional Source Beutler Lab
Gene Symbol Adcy9
Ensembl Gene ENSMUSG00000005580
Gene Nameadenylate cyclase 9
SynonymsD16Wsu65e, ACtp10
MMRRC Submission 044240-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R6081 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4287529-4420498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4294681 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 714 (D714G)
Ref Sequence ENSEMBL: ENSMUSP00000113421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005719] [ENSMUST00000117801] [ENSMUST00000120080]
Predicted Effect probably benign
Transcript: ENSMUST00000005719
AA Change: D951G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005719
Gene: ENSMUSG00000005580
AA Change: D951G

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117801
AA Change: D951G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113498
Gene: ENSMUSG00000005580
AA Change: D951G

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120080
AA Change: D714G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113421
Gene: ENSMUSG00000005580
AA Change: D714G

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 44 63 N/A INTRINSIC
CYCc 88 310 1.69e-63 SMART
transmembrane domain 554 576 N/A INTRINSIC
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
transmembrane domain 653 675 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
CYCc 786 990 1.26e-39 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show an increased IgG1 response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Adcy9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Adcy9 APN 16 4304582 missense probably benign
IGL00326:Adcy9 APN 16 4294696 missense probably benign
IGL00792:Adcy9 APN 16 4288539 missense probably damaging 1.00
IGL01610:Adcy9 APN 16 4418114 missense probably damaging 1.00
IGL02376:Adcy9 APN 16 4418680 missense probably benign 0.01
IGL02424:Adcy9 APN 16 4288597 missense probably damaging 1.00
IGL03097:Adcy9 UTSW 16 4418066 missense possibly damaging 0.94
PIT4243001:Adcy9 UTSW 16 4418407 missense probably damaging 1.00
R0043:Adcy9 UTSW 16 4289015 missense probably benign 0.12
R0085:Adcy9 UTSW 16 4288224 missense probably benign
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0371:Adcy9 UTSW 16 4288047 missense probably benign 0.06
R0613:Adcy9 UTSW 16 4419539 missense probably damaging 1.00
R0689:Adcy9 UTSW 16 4312804 splice site probably benign
R0744:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R0836:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R1223:Adcy9 UTSW 16 4298748 missense probably damaging 1.00
R1251:Adcy9 UTSW 16 4311531 missense probably damaging 0.99
R1689:Adcy9 UTSW 16 4297562 splice site probably null
R1922:Adcy9 UTSW 16 4311657 missense probably damaging 1.00
R1955:Adcy9 UTSW 16 4418659 missense possibly damaging 0.63
R1989:Adcy9 UTSW 16 4298727 missense probably damaging 1.00
R1998:Adcy9 UTSW 16 4297412 missense probably benign 0.00
R2321:Adcy9 UTSW 16 4288268 missense probably damaging 1.00
R3160:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3161:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R4065:Adcy9 UTSW 16 4288434 missense probably damaging 1.00
R4909:Adcy9 UTSW 16 4298754 missense probably benign 0.03
R5078:Adcy9 UTSW 16 4323907 missense probably benign 0.00
R5870:Adcy9 UTSW 16 4418368 missense probably damaging 1.00
R5968:Adcy9 UTSW 16 4298742 missense probably damaging 1.00
R5975:Adcy9 UTSW 16 4311567 missense probably damaging 0.98
R6014:Adcy9 UTSW 16 4418819 missense probably damaging 1.00
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6192:Adcy9 UTSW 16 4287954 missense probably benign
R6604:Adcy9 UTSW 16 4304407 missense probably damaging 0.98
R6739:Adcy9 UTSW 16 4418794 missense probably benign
R6829:Adcy9 UTSW 16 4307154 critical splice donor site probably null
R6986:Adcy9 UTSW 16 4311577 missense probably damaging 0.99
X0023:Adcy9 UTSW 16 4323916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTATGAAACAACTGTGATCGGATAC -3'
(R):5'- AGAGAAGGTGTTCACCAGCC -3'

Sequencing Primer
(F):5'- CTGTGATCGGATACTTTAATATGCAG -3'
(R):5'- TTCCCCAGGCAGCTTATAGAAG -3'
Posted On2017-07-14