Incidental Mutation 'R6081:Btnl4'
ID482932
Institutional Source Beutler Lab
Gene Symbol Btnl4
Ensembl Gene ENSMUSG00000058435
Gene Namebutyrophilin-like 4
SynonymsBtnl4, EG632126, NG11
MMRRC Submission 044240-MU
Accession Numbers

Genbank: NM_001039241; MGI: 1932036

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6081 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34469042-34475937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34474236 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 68 (W68C)
Ref Sequence ENSEMBL: ENSMUSP00000064161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065841]
Predicted Effect probably damaging
Transcript: ENSMUST00000065841
AA Change: W68C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064161
Gene: ENSMUSG00000058435
AA Change: W68C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.44e-7 SMART
Pfam:C2-set_2 150 233 3.6e-6 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
PRY 341 386 7.43e-2 SMART
SPRY 387 510 4.67e-20 SMART
low complexity region 514 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Btnl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:Btnl4 APN 17 34475927 missense probably benign 0.34
FR4589:Btnl4 UTSW 17 34472636 missense probably benign 0.30
N/A:Btnl4 UTSW 17 34472586 splice site probably benign
PIT4458001:Btnl4 UTSW 17 34474268 missense probably benign 0.25
R0601:Btnl4 UTSW 17 34469311 missense probably benign 0.07
R0718:Btnl4 UTSW 17 34469634 missense probably benign 0.44
R1163:Btnl4 UTSW 17 34470075 missense possibly damaging 0.65
R1823:Btnl4 UTSW 17 34475852 critical splice donor site probably null
R1954:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R1955:Btnl4 UTSW 17 34472930 missense possibly damaging 0.87
R4649:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4651:Btnl4 UTSW 17 34472628 missense probably benign 0.12
R4681:Btnl4 UTSW 17 34470101 splice site probably null
R6770:Btnl4 UTSW 17 34474037 missense probably benign 0.26
R6859:Btnl4 UTSW 17 34469379 missense probably damaging 1.00
R6885:Btnl4 UTSW 17 34472945 missense probably benign 0.00
R7265:Btnl4 UTSW 17 34475894 missense probably benign 0.00
R7316:Btnl4 UTSW 17 34469057 missense probably benign 0.06
X0023:Btnl4 UTSW 17 34475930 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TTCAGTTCCAAGATGGCCTC -3'
(R):5'- AGAGTGTGTTCTCTGCATCCTC -3'

Sequencing Primer
(F):5'- AACACTCCTTGCTGGAAGTG -3'
(R):5'- GTGTTCTCTGCATCCTCCTGTG -3'
Posted On2017-07-14