Incidental Mutation 'R6081:Cstf2t'
ID482936
Institutional Source Beutler Lab
Gene Symbol Cstf2t
Ensembl Gene ENSMUSG00000053536
Gene Namecleavage stimulation factor, 3' pre-RNA subunit 2, tau
Synonyms64kDa, tCstF-64
MMRRC Submission 044240-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R6081 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location31082841-31086590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31083123 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 20 (V20L)
Ref Sequence ENSEMBL: ENSMUSP00000093831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000066039] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066039
AA Change: V20L

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093831
Gene: ENSMUSG00000053536
AA Change: V20L

DomainStartEndE-ValueType
RRM 17 90 6.19e-29 SMART
Pfam:CSTF2_hinge 112 191 5.4e-32 PFAM
low complexity region 202 236 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 321 339 N/A INTRINSIC
low complexity region 364 379 N/A INTRINSIC
low complexity region 508 584 N/A INTRINSIC
Pfam:CSTF_C 588 628 7.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073581
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a targeted null allele are infertile due to low sperm counts, significant developmental defects in spermiogenesis, and variable abnormalities in epididymal sperm morphology and motility consistent with oligoasthenoteratozoospermia. Homozygous null females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Cstf2t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Cstf2t APN 19 31084338 missense probably benign 0.00
IGL01739:Cstf2t APN 19 31083136 missense probably damaging 1.00
IGL02466:Cstf2t APN 19 31083877 missense possibly damaging 0.88
R0064:Cstf2t UTSW 19 31083299 missense probably damaging 0.99
R0099:Cstf2t UTSW 19 31083831 missense probably benign 0.00
R0197:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R0423:Cstf2t UTSW 19 31084276 missense possibly damaging 0.89
R0883:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R1753:Cstf2t UTSW 19 31083685 missense possibly damaging 0.52
R2206:Cstf2t UTSW 19 31083775 missense probably benign 0.00
R2291:Cstf2t UTSW 19 31084864 missense probably benign 0.36
R3753:Cstf2t UTSW 19 31083295 missense probably damaging 1.00
R4523:Cstf2t UTSW 19 31083082 missense possibly damaging 0.47
R4991:Cstf2t UTSW 19 31084583 missense probably damaging 0.97
R5134:Cstf2t UTSW 19 31084094 missense probably damaging 1.00
R5863:Cstf2t UTSW 19 31083077 missense probably damaging 1.00
R6573:Cstf2t UTSW 19 31083780 missense probably benign 0.00
R7408:Cstf2t UTSW 19 31083193 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATTAGTCCGGTCTCAGGAAGC -3'
(R):5'- AGGTTTCGCATGGCACTGAG -3'

Sequencing Primer
(F):5'- TCTGCGGCCTAACGGAACTAC -3'
(R):5'- AGCGCAGTCTCCTGGTCTTG -3'
Posted On2017-07-14