Incidental Mutation 'R6057:Pikfyve'
ID 482938
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6057 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65311730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1989 (I1989N)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect possibly damaging
Transcript: ENSMUST00000081154
AA Change: I1944N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: I1944N

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: I1989N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: I1989N

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,156,500 (GRCm39) probably benign Het
Acan A G 7: 78,749,530 (GRCm39) S11G probably null Het
Ankrd13d A C 19: 4,332,256 (GRCm39) V56G probably damaging Het
Arl15 A G 13: 114,104,151 (GRCm39) Y76C probably damaging Het
Aspg G A 12: 112,087,432 (GRCm39) C296Y probably damaging Het
Astl T A 2: 127,187,889 (GRCm39) D101E probably benign Het
Bmpr2 A G 1: 59,881,977 (GRCm39) N202S probably benign Het
Borcs7 T C 19: 46,690,003 (GRCm39) *106Q probably null Het
Brip1 A G 11: 85,955,865 (GRCm39) S883P possibly damaging Het
Cacng2 A T 15: 78,002,991 (GRCm39) L34Q probably damaging Het
Catip A C 1: 74,402,077 (GRCm39) D84A probably damaging Het
Ccdc162 A G 10: 41,510,037 (GRCm39) L856S possibly damaging Het
Ccdc38 A G 10: 93,417,608 (GRCm39) K500E probably damaging Het
Ccser2 T C 14: 36,663,122 (GRCm39) K21E probably damaging Het
Cd93 A T 2: 148,283,439 (GRCm39) Y636N probably damaging Het
Cep128 A T 12: 91,262,998 (GRCm39) N300K possibly damaging Het
Cfap44 A G 16: 44,269,460 (GRCm39) T1155A probably benign Het
Clec16a T C 16: 10,447,951 (GRCm39) L550P probably damaging Het
Csmd3 T C 15: 47,618,787 (GRCm39) Y1867C probably damaging Het
Cul3 A T 1: 80,249,249 (GRCm39) I674N probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Cyp2d34 T C 15: 82,500,552 (GRCm39) H429R probably benign Het
Dab2ip T A 2: 35,582,267 (GRCm39) C4* probably null Het
Dcaf1 A G 9: 106,731,446 (GRCm39) E641G probably damaging Het
Dda1 T A 8: 71,927,276 (GRCm39) probably benign Het
Dmgdh C T 13: 93,888,960 (GRCm39) T866I probably benign Het
Ect2l T C 10: 18,037,250 (GRCm39) T383A probably benign Het
Ets2 A G 16: 95,515,416 (GRCm39) N181D probably benign Het
Ezh2 A G 6: 47,529,357 (GRCm39) F222L probably damaging Het
Frem3 T C 8: 81,342,216 (GRCm39) L1503P probably damaging Het
Fsip2 C A 2: 82,809,777 (GRCm39) A2032E probably damaging Het
Gm1818 C T 12: 48,602,346 (GRCm39) noncoding transcript Het
Gm9493 A G 19: 23,597,106 (GRCm39) S1G probably damaging Het
Grin2b A G 6: 135,710,942 (GRCm39) I868T possibly damaging Het
Ift22 A T 5: 136,939,987 (GRCm39) T17S possibly damaging Het
Il4ra T C 7: 125,170,735 (GRCm39) W216R probably damaging Het
Kcnj6 A T 16: 94,633,236 (GRCm39) W274R probably damaging Het
Kctd19 G A 8: 106,123,082 (GRCm39) H111Y probably damaging Het
Kremen2 A G 17: 23,961,679 (GRCm39) V276A probably benign Het
Lig1 C A 7: 13,022,598 (GRCm39) Q143K probably damaging Het
Lrp1 A T 10: 127,403,359 (GRCm39) D2071E probably damaging Het
Macf1 C T 4: 123,404,536 (GRCm39) M475I probably damaging Het
Mbtd1 G A 11: 93,820,485 (GRCm39) A427T probably damaging Het
Myof A G 19: 37,915,429 (GRCm39) probably null Het
Nbeal2 T C 9: 110,470,945 (GRCm39) D308G possibly damaging Het
Ncdn T C 4: 126,638,824 (GRCm39) Q665R probably benign Het
Nkd1 T C 8: 89,316,442 (GRCm39) probably null Het
Nktr G A 9: 121,577,455 (GRCm39) probably benign Het
Npc1l1 A T 11: 6,167,806 (GRCm39) M995K possibly damaging Het
Or10ag59 C A 2: 87,406,363 (GRCm39) R312S probably benign Het
Or11g7 A T 14: 50,691,201 (GRCm39) R231* probably null Het
Or14n1-ps1 T A 7: 86,092,397 (GRCm39) C69* probably null Het
Padi4 T C 4: 140,487,351 (GRCm39) T184A probably damaging Het
Pgm2l1 C T 7: 99,915,881 (GRCm39) P409S probably benign Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Pgr T C 9: 8,902,006 (GRCm39) L513P probably damaging Het
Prrc2a T C 17: 35,371,716 (GRCm39) T1806A probably benign Het
Psd T C 19: 46,311,753 (GRCm39) E309G possibly damaging Het
Qtrt1 C T 9: 21,323,299 (GRCm39) T50I probably damaging Het
Rims2 A C 15: 39,538,416 (GRCm39) T1320P probably damaging Het
Scn11a T G 9: 119,594,514 (GRCm39) N1293T probably damaging Het
Scn8a T C 15: 100,872,548 (GRCm39) F529S possibly damaging Het
Sec14l4 A T 11: 3,985,142 (GRCm39) D25V possibly damaging Het
Sema3a C T 5: 13,615,832 (GRCm39) R419C probably damaging Het
Slc12a1 T C 2: 125,032,133 (GRCm39) Y595H probably damaging Het
Slc25a28 A T 19: 43,655,364 (GRCm39) H170Q possibly damaging Het
Slc26a1 T A 5: 108,821,631 (GRCm39) Q86L probably damaging Het
Slc48a1 T A 15: 97,687,798 (GRCm39) W51R probably damaging Het
Sptlc3 T A 2: 139,423,533 (GRCm39) V309D probably damaging Het
Srcap G A 7: 127,140,528 (GRCm39) S1375N probably damaging Het
Tanc1 C A 2: 59,647,837 (GRCm39) H986Q possibly damaging Het
Tbc1d4 A G 14: 101,727,353 (GRCm39) V486A probably damaging Het
Tceanc2 T C 4: 107,004,776 (GRCm39) D124G probably damaging Het
Tdrd9 A G 12: 111,979,720 (GRCm39) M402V possibly damaging Het
Tmem132d T C 5: 127,861,934 (GRCm39) D729G probably damaging Het
Tmem62 T A 2: 120,807,943 (GRCm39) I55N probably damaging Het
Tnfrsf21 A T 17: 43,350,606 (GRCm39) N257Y possibly damaging Het
Trappc3 T C 4: 126,167,834 (GRCm39) L131P probably damaging Het
Vmn2r25 A T 6: 123,799,900 (GRCm39) M814K possibly damaging Het
Vmn2r87 T C 10: 130,308,226 (GRCm39) I671V probably benign Het
Vwa8 A T 14: 79,320,313 (GRCm39) D1108V probably benign Het
Xrcc4 C G 13: 90,139,198 (GRCm39) A241P possibly damaging Het
Xylt1 T A 7: 117,191,135 (GRCm39) D310E probably benign Het
Zfp27 T G 7: 29,594,444 (GRCm39) H507P possibly damaging Het
Zfp341 C T 2: 154,466,954 (GRCm39) P108S probably benign Het
Zfp641 T C 15: 98,190,816 (GRCm39) N76S probably benign Het
Zfp936 T C 7: 42,839,787 (GRCm39) V418A probably benign Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCAGTAACTACAAGGGATC -3'
(R):5'- CCTCTGAGATTCTGCTCCAG -3'

Posted On 2017-07-14