Incidental Mutation 'R6057:Cul3'
ID482940
Institutional Source Beutler Lab
Gene Symbol Cul3
Ensembl Gene ENSMUSG00000004364
Gene Namecullin 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location80264923-80340480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80271532 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 674 (I674N)
Ref Sequence ENSEMBL: ENSMUSP00000130738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163119] [ENSMUST00000164108]
PDB Structure
Solution structure of the cullin-3 homologue [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000163119
AA Change: I674N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130738
Gene: ENSMUSG00000004364
AA Change: I674N

DomainStartEndE-ValueType
PDB:4AP2|B 1 389 N/A PDB
SCOP:d1ldja2 30 382 1e-117 SMART
Blast:CULLIN 258 295 2e-15 BLAST
CULLIN 413 563 1.98e-90 SMART
Cullin_Nedd8 695 762 1.49e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164108
AA Change: I608N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131891
Gene: ENSMUSG00000004364
AA Change: I608N

DomainStartEndE-ValueType
SCOP:d1ldja2 23 316 1e-101 SMART
PDB:4APF|B 23 323 N/A PDB
Blast:CULLIN 192 229 1e-15 BLAST
CULLIN 347 497 1.98e-90 SMART
Cullin_Nedd8 629 696 1.49e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167794
Predicted Effect probably benign
Transcript: ENSMUST00000168372
SMART Domains Protein: ENSMUSP00000132485
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
Cullin_Nedd8 38 105 3.28e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192839
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cullin protein family. The encoded protein plays a critical role in the polyubiquitination and subsequent degradation of specific protein substrates as the core component and scaffold protein of an E3 ubiquitin ligase complex. Complexes including the encoded protein may also play a role in late endosome maturation. Mutations in this gene are a cause of type 2E pseudohypoaldosteronism. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a targeted null mutation accumulate cyclin E, exhibit abnormal cycling in cells of extraembryonic ectoderm and trophectoderm, reduced size, abnormal gastrulation and trophoblast cells, absence of an amnion, and death by embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Cul3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Cul3 APN 1 80288740 splice site probably benign
IGL01454:Cul3 APN 1 80304183 missense probably damaging 0.97
IGL01510:Cul3 APN 1 80282679 missense probably damaging 1.00
IGL01701:Cul3 APN 1 80277423 missense probably damaging 0.97
IGL02117:Cul3 APN 1 80323064 splice site probably benign
IGL02194:Cul3 APN 1 80323037 missense probably benign 0.03
IGL02217:Cul3 APN 1 80283767 missense probably damaging 0.97
IGL02417:Cul3 APN 1 80322902 missense probably damaging 1.00
IGL02445:Cul3 APN 1 80304169 missense possibly damaging 0.74
IGL02601:Cul3 APN 1 80271715 intron probably benign
IGL03201:Cul3 APN 1 80281427 missense probably damaging 1.00
R0467:Cul3 UTSW 1 80280863 missense probably benign 0.01
R0662:Cul3 UTSW 1 80271565 missense probably damaging 1.00
R0688:Cul3 UTSW 1 80271564 missense possibly damaging 0.63
R0761:Cul3 UTSW 1 80277486 unclassified probably benign
R0924:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0930:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0940:Cul3 UTSW 1 80322847 intron probably benign
R1117:Cul3 UTSW 1 80280924 missense probably damaging 1.00
R1572:Cul3 UTSW 1 80282789 missense possibly damaging 0.91
R2384:Cul3 UTSW 1 80283689 missense probably damaging 0.99
R3894:Cul3 UTSW 1 80283690 missense probably damaging 0.97
R4676:Cul3 UTSW 1 80271674 missense probably damaging 1.00
R4893:Cul3 UTSW 1 80288850 missense probably damaging 0.98
R4908:Cul3 UTSW 1 80280915 missense possibly damaging 0.91
R4910:Cul3 UTSW 1 80290089 missense probably benign 0.09
R5173:Cul3 UTSW 1 80281416 missense possibly damaging 0.94
R5787:Cul3 UTSW 1 80282721 missense probably benign 0.13
R5887:Cul3 UTSW 1 80276422 missense possibly damaging 0.94
R6066:Cul3 UTSW 1 80283759 missense probably benign 0.06
R6279:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6300:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6617:Cul3 UTSW 1 80276439 missense probably damaging 1.00
R7059:Cul3 UTSW 1 80276424 missense probably benign 0.00
R7223:Cul3 UTSW 1 80287000 missense probably benign 0.14
Z1088:Cul3 UTSW 1 80290091 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTTGCCATCAACATGACAGGC -3'
(R):5'- ATTCAACAAGAGACAGATATCCCTG -3'

Posted On2017-07-14