Incidental Mutation 'R6057:Ezh2'
ID482960
Institutional Source Beutler Lab
Gene Symbol Ezh2
Ensembl Gene ENSMUSG00000029687
Gene Nameenhancer of zeste 2 polycomb repressive complex 2 subunit
SynonymsEnx-1, KMT6, Enx1h
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location47530139-47595341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47552423 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 222 (F222L)
Ref Sequence ENSEMBL: ENSMUSP00000110265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618] [ENSMUST00000133043] [ENSMUST00000169889] [ENSMUST00000204798]
Predicted Effect probably damaging
Transcript: ENSMUST00000081721
AA Change: F231L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: F231L

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.1e-18 PFAM
SANT 159 250 9.7e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 555 592 1.05e-1 SMART
SET 612 733 4.15e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092648
AA Change: F231L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687
AA Change: F231L

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.9e-20 PFAM
SANT 159 250 9.7e-3 SMART
Blast:SET 272 333 3e-13 BLAST
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 513 550 1.05e-1 SMART
SET 570 691 4.15e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114616
AA Change: F192L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: F192L

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 2.5e-20 PFAM
SANT 120 211 9.7e-3 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 346 370 N/A INTRINSIC
SANT 389 437 6.62e-1 SMART
CXC 516 553 1.05e-1 SMART
SET 573 694 4.15e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114618
AA Change: F222L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: F222L

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 7.4e-20 PFAM
SANT 150 241 9.7e-3 SMART
low complexity region 345 362 N/A INTRINSIC
low complexity region 381 405 N/A INTRINSIC
SANT 424 472 6.62e-1 SMART
CXC 551 588 1.05e-1 SMART
SET 608 729 4.15e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133043
AA Change: F222L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118663
Gene: ENSMUSG00000029687
AA Change: F222L

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 2.5e-20 PFAM
Blast:SANT 150 233 3e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164006
SMART Domains Protein: ENSMUSP00000133195
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 96 1e-16 BLAST
low complexity region 98 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167278
SMART Domains Protein: ENSMUSP00000128542
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 43 6e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169889
AA Change: F53L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126481
Gene: ENSMUSG00000029687
AA Change: F53L

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Blast:SET 18 150 3e-45 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181519
Predicted Effect probably benign
Transcript: ENSMUST00000204798
SMART Domains Protein: ENSMUSP00000144780
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Ezh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Ezh2 APN 6 47556055 nonsense probably null
IGL01932:Ezh2 APN 6 47532048 missense probably damaging 0.99
IGL02019:Ezh2 APN 6 47551901 splice site probably null
IGL02748:Ezh2 APN 6 47558239 missense probably damaging 1.00
IGL02749:Ezh2 APN 6 47533764 missense probably damaging 0.99
IGL03171:Ezh2 APN 6 47540781 nonsense probably null
R0417:Ezh2 UTSW 6 47551726 missense probably benign 0.00
R1256:Ezh2 UTSW 6 47541855 nonsense probably null
R1587:Ezh2 UTSW 6 47552490 critical splice acceptor site probably null
R1631:Ezh2 UTSW 6 47577658 start codon destroyed probably null 0.01
R1736:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R1775:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R2076:Ezh2 UTSW 6 47576633 nonsense probably null
R2311:Ezh2 UTSW 6 47558260 missense probably damaging 1.00
R3751:Ezh2 UTSW 6 47556064 missense possibly damaging 0.94
R4016:Ezh2 UTSW 6 47544582 missense probably benign
R4119:Ezh2 UTSW 6 47544548 missense probably benign 0.00
R4214:Ezh2 UTSW 6 47533814 missense probably damaging 1.00
R4770:Ezh2 UTSW 6 47540696 missense probably damaging 1.00
R5133:Ezh2 UTSW 6 47540750 missense probably damaging 1.00
R5137:Ezh2 UTSW 6 47532080 splice site probably null
R5199:Ezh2 UTSW 6 47551725 missense probably benign 0.01
R5343:Ezh2 UTSW 6 47576615 missense probably damaging 1.00
R5584:Ezh2 UTSW 6 47532016 missense probably damaging 1.00
R5942:Ezh2 UTSW 6 47577582 missense possibly damaging 0.94
R7247:Ezh2 UTSW 6 47533774 missense probably damaging 1.00
R7284:Ezh2 UTSW 6 47544519 missense probably benign 0.00
R7365:Ezh2 UTSW 6 47533758 nonsense probably null
R7382:Ezh2 UTSW 6 47551836 missense possibly damaging 0.55
X0021:Ezh2 UTSW 6 47554169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATCTCTTCCAGCGTCCAG -3'
(R):5'- GGGACAAGTTCTTAGAAAATCAGC -3'

Posted On2017-07-14