Incidental Mutation 'R6057:Mbtd1'
ID482992
Institutional Source Beutler Lab
Gene Symbol Mbtd1
Ensembl Gene ENSMUSG00000059474
Gene Namembt domain containing 1
Synonymshemp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location93885852-93946985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93929659 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 427 (A427T)
Ref Sequence ENSEMBL: ENSMUSP00000070248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]
Predicted Effect probably damaging
Transcript: ENSMUST00000063645
AA Change: A427T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474
AA Change: A427T

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 7e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 459 1.61e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063718
AA Change: A449T

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474
AA Change: A449T

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
PDB:2W0T|A 74 96 7e-6 PDB
low complexity region 97 112 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
MBT 166 270 3.11e-22 SMART
MBT 278 379 1.28e-41 SMART
MBT 383 481 1.61e-38 SMART
MBT 489 585 4.11e-54 SMART
low complexity region 586 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107852
SMART Domains Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 5e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 433 1.29e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107853
AA Change: A427T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474
AA Change: A427T

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107854
AA Change: A427T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474
AA Change: A427T

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155841
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Mbtd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Mbtd1 APN 11 93943840 missense possibly damaging 0.94
IGL00819:Mbtd1 APN 11 93931811 critical splice acceptor site probably null
IGL01140:Mbtd1 APN 11 93924432 missense probably damaging 1.00
IGL01553:Mbtd1 APN 11 93923214 missense probably benign 0.35
IGL01893:Mbtd1 APN 11 93921412 missense probably null
IGL02218:Mbtd1 APN 11 93931803 splice site probably benign
IGL02406:Mbtd1 APN 11 93908858 missense probably damaging 1.00
IGL03002:Mbtd1 APN 11 93924490 missense probably benign 0.15
IGL03347:Mbtd1 APN 11 93923179 missense probably benign 0.01
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0311:Mbtd1 UTSW 11 93921357 splice site probably null
R0513:Mbtd1 UTSW 11 93932212 splice site probably null
R0646:Mbtd1 UTSW 11 93905212 missense probably damaging 1.00
R0734:Mbtd1 UTSW 11 93923146 missense probably damaging 1.00
R0835:Mbtd1 UTSW 11 93931839 missense probably benign 0.23
R1295:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1296:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1996:Mbtd1 UTSW 11 93932396 frame shift probably null
R2157:Mbtd1 UTSW 11 93910388 missense probably benign 0.20
R3977:Mbtd1 UTSW 11 93905175 missense probably benign
R4435:Mbtd1 UTSW 11 93932222 missense probably benign
R4589:Mbtd1 UTSW 11 93921419 missense probably damaging 1.00
R4647:Mbtd1 UTSW 11 93924611 missense probably damaging 1.00
R4824:Mbtd1 UTSW 11 93925702 missense probably benign 0.00
R4919:Mbtd1 UTSW 11 93923148 unclassified probably null
R5045:Mbtd1 UTSW 11 93931815 missense probably benign 0.26
R5095:Mbtd1 UTSW 11 93929671 missense probably damaging 1.00
R5227:Mbtd1 UTSW 11 93924648 missense possibly damaging 0.54
R5619:Mbtd1 UTSW 11 93929879 intron probably null
R6293:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6294:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6295:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6297:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6998:Mbtd1 UTSW 11 93924612 missense probably damaging 1.00
R7423:Mbtd1 UTSW 11 93943796 missense probably benign 0.38
X0024:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAAGCATCTTAAGTCATCCCTTTG -3'
(R):5'- CGTACAACAACTAAGATTAGGGC -3'

Posted On2017-07-14