Incidental Mutation 'R6059:Lcn9'
ID483104
Institutional Source Beutler Lab
Gene Symbol Lcn9
Ensembl Gene ENSMUSG00000023210
Gene Namelipocalin 9
Synonyms
MMRRC Submission 044225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.028) question?
Stock #R6059 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25823153-25825537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25824725 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 159 (L159I)
Ref Sequence ENSEMBL: ENSMUSP00000023978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023978
AA Change: L159I

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023978
Gene: ENSMUSG00000023210
AA Change: L159I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipocalin 34 174 6e-37 PFAM
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the lipocalin family, such as LCN9, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik C A 17: 48,090,327 T44K probably benign Het
4931406P16Rik G A 7: 34,245,463 A452V possibly damaging Het
Ablim2 A G 5: 35,857,164 D189G probably benign Het
Abo A G 2: 26,843,353 V278A possibly damaging Het
Anxa1 A G 19: 20,377,700 F237L possibly damaging Het
Atp11b A G 3: 35,814,177 Y466C possibly damaging Het
Cfh T A 1: 140,118,690 K531N possibly damaging Het
Cgref1 G T 5: 30,945,384 P31Q probably damaging Het
Clca3a2 G A 3: 144,810,770 A355V probably damaging Het
Cntnap5c T A 17: 58,313,712 C929S probably damaging Het
Col6a6 A T 9: 105,783,917 V331D probably damaging Het
Cyp4a12b T A 4: 115,438,104 V469E possibly damaging Het
Dchs2 A G 3: 83,355,736 S3104G probably benign Het
Ddx24 G T 12: 103,408,300 A875E probably damaging Het
Dsc1 A T 18: 20,110,242 N51K probably damaging Het
Epb41l3 A G 17: 69,284,642 E708G probably damaging Het
Epb41l3 C T 17: 69,286,798 T537I probably damaging Het
Fam162b A T 10: 51,590,307 C39S probably benign Het
Gbf1 T C 19: 46,265,248 I531T probably damaging Het
Glipr1l2 T C 10: 112,083,518 V48A probably benign Het
Gm11639 T C 11: 105,036,769 I4788T probably benign Het
Gm13023 T G 4: 143,793,980 S101A possibly damaging Het
Gorasp1 A G 9: 119,930,006 V177A probably damaging Het
Gys1 A G 7: 45,455,288 probably null Het
Hif1a T A 12: 73,941,800 V523E probably damaging Het
Hnrnph3 A T 10: 63,018,862 probably benign Het
Luzp1 C T 4: 136,541,480 A338V probably benign Het
Map3k10 A T 7: 27,656,822 S891T probably damaging Het
Mmrn2 C T 14: 34,397,591 Q97* probably null Het
Mov10 G A 3: 104,817,950 probably benign Het
Ncam1 A C 9: 49,544,666 Y551D probably damaging Het
Ncf1 A T 5: 134,223,487 Y237N probably damaging Het
Nipbl A T 15: 8,295,568 I2537N probably damaging Het
Nlrp1b A T 11: 71,217,010 V555E possibly damaging Het
Nod2 T C 8: 88,664,414 Y428H probably damaging Het
Nup133 C A 8: 123,914,596 A862S probably damaging Het
Pcdhgb2 T A 18: 37,690,025 L23* probably null Het
Pclo A G 5: 14,811,700 E4889G unknown Het
Plcd3 T A 11: 103,080,401 I110F possibly damaging Het
Plxna2 C A 1: 194,810,971 N1851K possibly damaging Het
Ppp2r5c C A 12: 110,574,788 A457E probably benign Het
Ppp5c C T 7: 17,027,907 probably benign Het
Prg4 T A 1: 150,449,997 Y1009F possibly damaging Het
Rcor3 A T 1: 192,119,940 M303K probably benign Het
Rrn3 G A 16: 13,806,604 M433I probably benign Het
Serpinb9e G A 13: 33,257,774 V230M probably benign Het
Shisa6 T A 11: 66,224,974 H279L probably damaging Het
Slc38a11 A T 2: 65,334,745 I234N probably damaging Het
Socs1 G C 16: 10,784,530 F114L probably damaging Het
Ssc5d C T 7: 4,942,744 T925M possibly damaging Het
Stc1 T C 14: 69,032,438 S156P probably damaging Het
Ttc5 C G 14: 50,777,846 V103L probably damaging Het
Vmn1r73 A G 7: 11,756,611 T119A probably benign Het
Vmn2r99 G A 17: 19,378,980 D309N probably benign Het
Vps53 T C 11: 76,066,867 H353R possibly damaging Het
Ythdf3 T A 3: 16,203,192 Y47* probably null Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Other mutations in Lcn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Lcn9 APN 2 25824538 missense probably damaging 1.00
IGL02417:Lcn9 APN 2 25823680 missense possibly damaging 0.91
PIT4418001:Lcn9 UTSW 2 25824541 missense probably damaging 1.00
R1479:Lcn9 UTSW 2 25823703 splice site probably benign
R1657:Lcn9 UTSW 2 25824710 missense probably benign 0.17
R4199:Lcn9 UTSW 2 25824761 missense probably benign 0.15
R4526:Lcn9 UTSW 2 25824508 missense possibly damaging 0.85
R4570:Lcn9 UTSW 2 25823579 missense probably benign 0.04
R5232:Lcn9 UTSW 2 25824055 critical splice donor site probably null
R5577:Lcn9 UTSW 2 25823651 missense probably damaging 1.00
R5849:Lcn9 UTSW 2 25823256 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGACCCTATCTGTTTGGGAATC -3'
(R):5'- TTCACATACCAGAAGGCCTG -3'

Sequencing Primer
(F):5'- AAGTCCCAAATCTGTCCC -3'
(R):5'- GGTTCCTCTATGGTCTATAAAAAGC -3'
Posted On2017-07-14