Incidental Mutation 'R6060:Olfr420'
ID483165
Institutional Source Beutler Lab
Gene Symbol Olfr420
Ensembl Gene ENSMUSG00000055033
Gene Nameolfactory receptor 420
SynonymsGA_x6K02T2P20D-20995211-20994246, MOR105-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6060 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174155633-174162195 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 174159341 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 189 (C189*)
Ref Sequence ENSEMBL: ENSMUSP00000149052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068403] [ENSMUST00000213748]
Predicted Effect probably null
Transcript: ENSMUST00000068403
AA Change: C189*
SMART Domains Protein: ENSMUSP00000069662
Gene: ENSMUSG00000055033
AA Change: C189*

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 9.9e-60 PFAM
Pfam:7tm_1 41 292 4.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213748
AA Change: C189*
Meta Mutation Damage Score 0.688 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 89,169,742 probably null Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K probably benign Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L possibly damaging Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in Olfr420
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr420 APN 1 174158857 missense probably damaging 1.00
IGL02479:Olfr420 APN 1 174158954 nonsense probably null
IGL03190:Olfr420 APN 1 174159544 missense probably damaging 0.99
IGL03270:Olfr420 APN 1 174159553 missense probably benign 0.04
R0645:Olfr420 UTSW 1 174159354 missense probably benign 0.00
R0834:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R1432:Olfr420 UTSW 1 174158917 missense possibly damaging 0.67
R1508:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R2351:Olfr420 UTSW 1 174158920 missense probably damaging 0.99
R3440:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R3441:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R4571:Olfr420 UTSW 1 174158928 missense possibly damaging 0.77
R5072:Olfr420 UTSW 1 174158961 missense probably damaging 1.00
R6166:Olfr420 UTSW 1 174159093 missense probably benign 0.43
R6228:Olfr420 UTSW 1 174152146 missense probably benign 0.00
R6272:Olfr420 UTSW 1 174159175 missense probably benign 0.02
R6298:Olfr420 UTSW 1 174152182 missense probably benign 0.02
R6400:Olfr420 UTSW 1 174159264 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATACCTGGCTATCTGCAGC -3'
(R):5'- TGGCAGTGTCCCAGAACAAG -3'

Sequencing Primer
(F):5'- GCTATCTGCAGCCCTCTTCATTATC -3'
(R):5'- CAGTGTCCCAGAACAAGGAGTAG -3'
Posted On2017-07-14