Incidental Mutation 'R6060:Mknk2'
ID483197
Institutional Source Beutler Lab
Gene Symbol Mknk2
Ensembl Gene ENSMUSG00000020190
Gene NameMAP kinase-interacting serine/threonine kinase 2
SynonymsMnk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6060 (G1)
Quality Score224.009
Status Validated
Chromosome10
Chromosomal Location80665327-80678112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80671634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 76 (D76E)
Ref Sequence ENSEMBL: ENSMUSP00000143679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003433] [ENSMUST00000197276] [ENSMUST00000198819] [ENSMUST00000199949] [ENSMUST00000200082]
Predicted Effect probably benign
Transcript: ENSMUST00000003433
AA Change: D41E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003433
Gene: ENSMUSG00000020190
AA Change: D41E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
S_TKc 36 321 7.09e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197276
AA Change: D76E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143679
Gene: ENSMUSG00000020190
AA Change: D76E

DomainStartEndE-ValueType
SCOP:d1koba_ 52 118 3e-11 SMART
PDB:2AC3|A 59 118 3e-32 PDB
Blast:S_TKc 71 118 1e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198819
AA Change: D41E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000199949
Predicted Effect probably benign
Transcript: ENSMUST00000200082
AA Change: D88E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143508
Gene: ENSMUSG00000020190
AA Change: D88E

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
S_TKc 83 368 7.09e-88 SMART
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine-protein kinase, which is targeted by both the extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways. This enzyme targets several substrates including eukaryotic translation initiation factor 4E and mammalian target of rapamycin, which are negatively regulated by its phosphorylation. Null mutant mice do not exhibit developmental or reproductive defects. However, mice null for both this protein and mitogen-activated protein kinase-interacting serine/threonine protein kinase 1 have delayed tumor development in phosphatase and tensin homolog mutant mice, indicating an oncogenic function for this gene in tumor development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 89,169,742 probably null Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L possibly damaging Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Prl7a1 G A 13: 27,637,588 P122S probably damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in Mknk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Mknk2 APN 10 80667664 splice site probably benign
IGL02471:Mknk2 APN 10 80668121 missense probably damaging 0.99
IGL02643:Mknk2 APN 10 80668601 missense probably damaging 1.00
H8562:Mknk2 UTSW 10 80668934 splice site probably benign
IGL03052:Mknk2 UTSW 10 80669662 missense probably benign 0.12
R0645:Mknk2 UTSW 10 80671908 unclassified probably null
R2061:Mknk2 UTSW 10 80671557 critical splice donor site probably null
R2105:Mknk2 UTSW 10 80668601 missense possibly damaging 0.90
R2167:Mknk2 UTSW 10 80668701 missense probably damaging 1.00
R3847:Mknk2 UTSW 10 80667975 nonsense probably null
R4649:Mknk2 UTSW 10 80669339 missense probably damaging 1.00
R5062:Mknk2 UTSW 10 80671769 missense probably damaging 1.00
R5358:Mknk2 UTSW 10 80671763 missense probably benign 0.19
R5433:Mknk2 UTSW 10 80667225 missense probably benign 0.00
R5518:Mknk2 UTSW 10 80668641 missense possibly damaging 0.92
R5813:Mknk2 UTSW 10 80675862 missense probably benign 0.34
R6151:Mknk2 UTSW 10 80669025 unclassified probably null
R6366:Mknk2 UTSW 10 80671933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACCTGGATTCCCAAGGTG -3'
(R):5'- TACAGACATGCCTTCCAGC -3'

Sequencing Primer
(F):5'- TGGCCAGTCACAAGTCTTAG -3'
(R):5'- GCCCATTGACATCCCAGATG -3'
Posted On2017-07-14