Incidental Mutation 'R6060:Prl7a1'
ID483201
Institutional Source Beutler Lab
Gene Symbol Prl7a1
Ensembl Gene ENSMUSG00000006488
Gene Nameprolactin family 7, subfamily a, member 1
SynonymsPLP-G, Prlpg, Prlpe, PLP-E
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6060 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location27633366-27642493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27637588 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 122 (P122S)
Ref Sequence ENSEMBL: ENSMUSP00000093614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006659] [ENSMUST00000095924] [ENSMUST00000224852]
Predicted Effect probably damaging
Transcript: ENSMUST00000006659
AA Change: P121S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006659
Gene: ENSMUSG00000006488
AA Change: P121S

DomainStartEndE-ValueType
Pfam:Hormone_1 16 82 9.9e-8 PFAM
Pfam:Hormone_1 82 256 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095924
AA Change: P122S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093614
Gene: ENSMUSG00000006488
AA Change: P122S

DomainStartEndE-ValueType
Pfam:Hormone_1 17 257 7.8e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224852
AA Change: P121S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.562 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110057P08Rik A G 16: 89,169,742 probably null Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Ago4 A G 4: 126,507,009 probably null Het
Ajap1 G A 4: 153,432,242 T214I probably damaging Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cp G T 3: 19,968,072 D213Y probably damaging Het
Crocc G A 4: 141,036,718 T702M possibly damaging Het
Cyp2c70 A T 19: 40,165,413 L244* probably null Het
Cyp2d22 T C 15: 82,375,885 T6A probably benign Het
D630045J12Rik T C 6: 38,130,864 E1829G probably damaging Het
Dnajc4 G T 19: 6,990,725 S61* probably null Het
Dpysl4 A G 7: 139,089,408 M1V probably null Het
Emc1 T C 4: 139,363,169 Y407H probably damaging Het
Fam149a T A 8: 45,358,762 probably benign Het
Fam184b T C 5: 45,553,147 E547G probably damaging Het
Fam47e T A 5: 92,579,613 F127I possibly damaging Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Kctd4 A T 14: 75,962,789 I67F probably benign Het
Lama3 A T 18: 12,556,663 I2821F probably damaging Het
Lpxn T C 19: 12,833,125 L311P probably damaging Het
Lrp1b A T 2: 40,750,934 N3499K probably benign Het
Mknk2 A T 10: 80,671,634 D76E probably benign Het
Mthfd1l C G 10: 4,148,095 F977L probably damaging Het
Ncam1 A G 9: 49,531,959 probably benign Het
Nectin2 A T 7: 19,717,775 Y445N probably damaging Het
Ngb A C 12: 87,100,189 S85A probably benign Het
Nr3c1 T C 18: 39,415,847 K692R probably damaging Het
Nrp1 C A 8: 128,497,938 H727Q probably damaging Het
Olfr1466 C T 19: 13,342,133 A125V probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pold3 A C 7: 100,100,612 Y115* probably null Het
Ppp1r12b C G 1: 134,955,524 V87L possibly damaging Het
Ppp1r26 A G 2: 28,451,030 N224S probably benign Het
Rabep1 T A 11: 70,874,786 N25K possibly damaging Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf32 A T 5: 29,206,754 I214L probably benign Het
Safb2 A T 17: 56,563,246 probably null Het
Serpinb6e A G 13: 33,841,273 C12R possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Slc12a4 G A 8: 105,945,706 A821V probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc41a1 A G 1: 131,840,234 M179V probably benign Het
Slc9a3 A G 13: 74,150,885 Y141C probably damaging Het
Tenm4 G A 7: 96,873,711 V1450I probably damaging Het
Tnk1 A G 11: 69,853,593 I408T possibly damaging Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Ttll13 G A 7: 80,258,743 R576H probably damaging Het
Ubr4 T C 4: 139,479,062 probably null Het
Vmn2r5 C T 3: 64,503,815 C444Y probably damaging Het
Zar1 T A 5: 72,580,929 R43S probably benign Het
Zfp455 A G 13: 67,207,193 Y175C probably damaging Het
Other mutations in Prl7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Prl7a1 APN 13 27640795 missense probably damaging 0.97
IGL02862:Prl7a1 APN 13 27639889 missense probably benign 0.05
R0841:Prl7a1 UTSW 13 27642410 splice site probably benign
R1005:Prl7a1 UTSW 13 27642446 missense possibly damaging 0.75
R1641:Prl7a1 UTSW 13 27633629 missense probably damaging 1.00
R1991:Prl7a1 UTSW 13 27633672 missense probably damaging 0.96
R2233:Prl7a1 UTSW 13 27642419 critical splice donor site probably null
R4061:Prl7a1 UTSW 13 27635849 missense possibly damaging 0.83
R4239:Prl7a1 UTSW 13 27637566 missense possibly damaging 0.92
R4817:Prl7a1 UTSW 13 27635764 missense probably damaging 0.99
R4976:Prl7a1 UTSW 13 27633581 missense possibly damaging 0.52
R4992:Prl7a1 UTSW 13 27635686 splice site probably null
R5119:Prl7a1 UTSW 13 27633581 missense possibly damaging 0.52
R5857:Prl7a1 UTSW 13 27640701 missense probably damaging 0.99
R6164:Prl7a1 UTSW 13 27637643 missense probably benign 0.00
R6581:Prl7a1 UTSW 13 27633629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGACTTGTGACAGTATTACTTAGC -3'
(R):5'- ACTAGGCCCAGATTCTAAGGAAAG -3'

Sequencing Primer
(F):5'- TGTGACAGTATTACTTAGCATTTCC -3'
(R):5'- TGAATTGAGGTTTGACATTCAGATG -3'
Posted On2017-07-14