Incidental Mutation 'R6046:Atp9a'
ID483266
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission 044214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6046 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 168634870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1000 (V1000L)
Ref Sequence ENSEMBL: ENSMUSP00000104804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect probably benign
Transcript: ENSMUST00000029060
AA Change: V1016L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: V1016L

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109175
AA Change: V1000L

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: V1000L

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109176
AA Change: V1074L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: V1074L

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109177
AA Change: V998L

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: V998L

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178504
AA Change: V1016L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: V1016L

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 T C 7: 28,904,619 I406V probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ank1 T A 8: 23,116,098 F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Bnip3 A G 7: 138,909,304 probably benign Het
Btbd11 T C 10: 85,388,083 V252A unknown Het
Btnl6 T A 17: 34,508,397 R386S probably damaging Het
Calcrl A G 2: 84,375,314 V11A probably benign Het
Cc2d1a G T 8: 84,136,942 A597D possibly damaging Het
Celsr3 A G 9: 108,837,151 T1960A probably benign Het
Cfb T A 17: 34,862,102 probably null Het
Chd8 A G 14: 52,221,071 I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 probably null Het
Crhr2 T A 6: 55,091,292 T428S probably damaging Het
Crybg2 A T 4: 134,092,077 I1753F probably damaging Het
Ctsq A T 13: 61,039,141 V46E probably benign Het
Cxcr1 T C 1: 74,192,281 E194G probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Dpyd T A 3: 119,431,575 M999K probably benign Het
Gbp3 A C 3: 142,567,799 D369A possibly damaging Het
Glmp A G 3: 88,325,188 E36G probably damaging Het
Gm10113 T C 13: 46,177,443 noncoding transcript Het
Gm6486 T A 5: 3,070,846 noncoding transcript Het
Gm973 T G 1: 59,632,350 L891R unknown Het
Heatr3 C T 8: 88,139,954 T8M probably damaging Het
Herc1 A G 9: 66,445,549 M2106V probably damaging Het
Hfm1 A T 5: 106,898,643 probably null Het
Hspa14 A G 2: 3,489,764 V462A possibly damaging Het
Hspa5 C A 2: 34,775,749 T535K possibly damaging Het
Ift140 A G 17: 25,055,589 D745G probably benign Het
Ift27 A T 15: 78,173,781 C8S possibly damaging Het
Irak1bp1 G A 9: 82,846,563 W182* probably null Het
Itga3 A G 11: 95,062,715 I236T probably benign Het
Kctd15 T A 7: 34,650,122 N26Y possibly damaging Het
Kdm1b T C 13: 47,079,253 V733A possibly damaging Het
Lhx8 A T 3: 154,321,703 L234H probably damaging Het
Lrp2 T A 2: 69,506,754 T1225S probably damaging Het
Lrrn1 G A 6: 107,568,527 D429N probably benign Het
Mettl3 A T 14: 52,298,786 N200K possibly damaging Het
Mixl1 G T 1: 180,696,771 A81D possibly damaging Het
Mroh2b T C 15: 4,951,281 I1444T probably benign Het
Muc15 T A 2: 110,731,441 L74* probably null Het
Olfm2 T A 9: 20,668,528 Y317F probably damaging Het
Olfr1468-ps1 G A 19: 13,375,334 S124N probably benign Het
Olfr474 T A 7: 107,954,794 I51N probably benign Het
Olfr622 C T 7: 103,639,679 V154M probably benign Het
Pclo A T 5: 14,713,288 Y3925F unknown Het
Pik3c2g A T 6: 139,622,139 R84S probably damaging Het
Pik3c2g A G 6: 139,896,792 Q449R probably damaging Het
Psg28 T C 7: 18,426,380 E297G probably damaging Het
Qrich2 A T 11: 116,447,006 probably benign Het
Rgs9 A G 11: 109,239,560 I363T probably damaging Het
Rnpepl1 A G 1: 92,916,821 D345G probably damaging Het
Rtn4 T A 11: 29,708,023 F726I probably damaging Het
Sart3 A T 5: 113,755,446 I330N probably damaging Het
Scn5a T C 9: 119,562,374 D84G probably damaging Het
Sema4a T C 3: 88,440,701 T438A probably damaging Het
Sfxn1 A C 13: 54,088,942 Y73S probably benign Het
Slc24a2 A G 4: 86,996,645 M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 V656A probably benign Het
Smok2a T G 17: 13,226,134 D199E probably benign Het
Tbc1d10c T C 19: 4,185,031 I344V probably benign Het
Tll1 A T 8: 64,053,891 Y605* probably null Het
Trim75 G A 8: 64,982,883 P305L probably damaging Het
Unc13c T C 9: 73,930,884 N895S probably benign Het
Vmn2r25 A T 6: 123,822,917 I822N probably damaging Het
Wasf3 T G 5: 146,470,356 D495E unknown Het
Wdhd1 T A 14: 47,273,210 K119* probably null Het
Wnt2b T A 3: 104,951,023 D310V probably damaging Het
Zfat G T 15: 68,180,777 D389E probably damaging Het
Zfp282 G A 6: 47,880,168 V112M probably damaging Het
Zfp617 A T 8: 71,933,413 K529I probably damaging Het
Zfp866 A T 8: 69,765,723 C416S probably damaging Het
Zfp991 G A 4: 147,179,765 G533D probably benign Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
R7490:Atp9a UTSW 2 168675352 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGGAACTTGACCTCCTC -3'
(R):5'- GCTGAAAGTTAACGTTTCACCC -3'

Sequencing Primer
(F):5'- GAACTTGACCTCCTCCTGGG -3'
(R):5'- GTTAACGTTTCACCCAATGTGG -3'
Posted On2017-07-14