Incidental Mutation 'R6046:Pik3c2g'
ID483286
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 044214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6046 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139622139 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 84 (R84S)
Ref Sequence ENSEMBL: ENSMUSP00000141141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]
Predicted Effect probably damaging
Transcript: ENSMUST00000032353
AA Change: R84S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: R84S

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185968
AA Change: R84S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: R84S

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186585
Predicted Effect probably damaging
Transcript: ENSMUST00000187618
AA Change: R84S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: R84S

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000188066
AA Change: R84S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000190962
AA Change: R84S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: R84S

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 T C 7: 28,904,619 I406V probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ank1 T A 8: 23,116,098 F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Atp9a C A 2: 168,634,870 V1000L probably benign Het
Bnip3 A G 7: 138,909,304 probably benign Het
Btbd11 T C 10: 85,388,083 V252A unknown Het
Btnl6 T A 17: 34,508,397 R386S probably damaging Het
Calcrl A G 2: 84,375,314 V11A probably benign Het
Cc2d1a G T 8: 84,136,942 A597D possibly damaging Het
Celsr3 A G 9: 108,837,151 T1960A probably benign Het
Cfb T A 17: 34,862,102 probably null Het
Chd8 A G 14: 52,221,071 I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 probably null Het
Crhr2 T A 6: 55,091,292 T428S probably damaging Het
Crybg2 A T 4: 134,092,077 I1753F probably damaging Het
Ctsq A T 13: 61,039,141 V46E probably benign Het
Cxcr1 T C 1: 74,192,281 E194G probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Dpyd T A 3: 119,431,575 M999K probably benign Het
Gbp3 A C 3: 142,567,799 D369A possibly damaging Het
Glmp A G 3: 88,325,188 E36G probably damaging Het
Gm10113 T C 13: 46,177,443 noncoding transcript Het
Gm6486 T A 5: 3,070,846 noncoding transcript Het
Gm973 T G 1: 59,632,350 L891R unknown Het
Heatr3 C T 8: 88,139,954 T8M probably damaging Het
Herc1 A G 9: 66,445,549 M2106V probably damaging Het
Hfm1 A T 5: 106,898,643 probably null Het
Hspa14 A G 2: 3,489,764 V462A possibly damaging Het
Hspa5 C A 2: 34,775,749 T535K possibly damaging Het
Ift140 A G 17: 25,055,589 D745G probably benign Het
Ift27 A T 15: 78,173,781 C8S possibly damaging Het
Irak1bp1 G A 9: 82,846,563 W182* probably null Het
Itga3 A G 11: 95,062,715 I236T probably benign Het
Kctd15 T A 7: 34,650,122 N26Y possibly damaging Het
Kdm1b T C 13: 47,079,253 V733A possibly damaging Het
Lhx8 A T 3: 154,321,703 L234H probably damaging Het
Lrp2 T A 2: 69,506,754 T1225S probably damaging Het
Lrrn1 G A 6: 107,568,527 D429N probably benign Het
Mettl3 A T 14: 52,298,786 N200K possibly damaging Het
Mixl1 G T 1: 180,696,771 A81D possibly damaging Het
Mroh2b T C 15: 4,951,281 I1444T probably benign Het
Muc15 T A 2: 110,731,441 L74* probably null Het
Olfm2 T A 9: 20,668,528 Y317F probably damaging Het
Olfr1468-ps1 G A 19: 13,375,334 S124N probably benign Het
Olfr474 T A 7: 107,954,794 I51N probably benign Het
Olfr622 C T 7: 103,639,679 V154M probably benign Het
Pclo A T 5: 14,713,288 Y3925F unknown Het
Psg28 T C 7: 18,426,380 E297G probably damaging Het
Qrich2 A T 11: 116,447,006 probably benign Het
Rgs9 A G 11: 109,239,560 I363T probably damaging Het
Rnpepl1 A G 1: 92,916,821 D345G probably damaging Het
Rtn4 T A 11: 29,708,023 F726I probably damaging Het
Sart3 A T 5: 113,755,446 I330N probably damaging Het
Scn5a T C 9: 119,562,374 D84G probably damaging Het
Sema4a T C 3: 88,440,701 T438A probably damaging Het
Sfxn1 A C 13: 54,088,942 Y73S probably benign Het
Slc24a2 A G 4: 86,996,645 M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 V656A probably benign Het
Smok2a T G 17: 13,226,134 D199E probably benign Het
Tbc1d10c T C 19: 4,185,031 I344V probably benign Het
Tll1 A T 8: 64,053,891 Y605* probably null Het
Trim75 G A 8: 64,982,883 P305L probably damaging Het
Unc13c T C 9: 73,930,884 N895S probably benign Het
Vmn2r25 A T 6: 123,822,917 I822N probably damaging Het
Wasf3 T G 5: 146,470,356 D495E unknown Het
Wdhd1 T A 14: 47,273,210 K119* probably null Het
Wnt2b T A 3: 104,951,023 D310V probably damaging Het
Zfat G T 15: 68,180,777 D389E probably damaging Het
Zfp282 G A 6: 47,880,168 V112M probably damaging Het
Zfp617 A T 8: 71,933,413 K529I probably damaging Het
Zfp866 A T 8: 69,765,723 C416S probably damaging Het
Zfp991 G A 4: 147,179,765 G533D probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139967894 missense unknown
R7385:Pik3c2g UTSW 6 139855353 missense
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATACAGTTGGCAAACAG -3'
(R):5'- CGAATCTGGGATACTCGATGC -3'

Sequencing Primer
(F):5'- CACAGGAAGATGGATCTGATACCC -3'
(R):5'- CGATGCCATGATATTTTCCACTGGG -3'
Posted On2017-07-14