Incidental Mutation 'R6046:Scn5a'
ID483307
Institutional Source Beutler Lab
Gene Symbol Scn5a
Ensembl Gene ENSMUSG00000032511
Gene Namesodium channel, voltage-gated, type V, alpha
SynonymsNav1.5c, Nav1.5, mH1, SkM2
MMRRC Submission 044214-MU
Accession Numbers

Ncbi RefSeq: NM_021544.4, NM_001253860.1; MGI:98251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6046 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119483408-119579016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119562374 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 84 (D84G)
Ref Sequence ENSEMBL: ENSMUSP00000113272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065196] [ENSMUST00000117911] [ENSMUST00000120420] [ENSMUST00000138934]
Predicted Effect probably damaging
Transcript: ENSMUST00000065196
AA Change: D84G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066228
Gene: ENSMUSG00000032511
AA Change: D84G

DomainStartEndE-ValueType
Pfam:Ion_trans 130 423 2.4e-82 PFAM
Pfam:Na_trans_cytopl 478 667 5.2e-49 PFAM
Pfam:Ion_trans 716 950 1.1e-54 PFAM
Pfam:Na_trans_assoc 955 1203 2.9e-57 PFAM
Pfam:Ion_trans 1207 1484 2e-66 PFAM
Pfam:Ion_trans 1530 1786 7.2e-55 PFAM
Pfam:PKD_channel 1627 1780 3.5e-7 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117911
AA Change: D84G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112838
Gene: ENSMUSG00000032511
AA Change: D84G

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 9.6e-76 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 4.9e-44 PFAM
Pfam:Ion_trans 751 940 2.3e-46 PFAM
Pfam:Na_trans_assoc 955 1218 1.2e-73 PFAM
Pfam:Ion_trans 1244 1472 2e-56 PFAM
PDB:1BYY|A 1474 1526 5e-29 PDB
Pfam:Ion_trans 1565 1774 1.5e-49 PFAM
Pfam:PKD_channel 1627 1781 2.6e-10 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120420
AA Change: D84G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113272
Gene: ENSMUSG00000032511
AA Change: D84G

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 4.5e-75 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 7.4e-43 PFAM
Pfam:Ion_trans 751 940 1.2e-45 PFAM
Pfam:Na_trans_assoc 955 1217 1.6e-72 PFAM
Pfam:Ion_trans 1243 1471 1.1e-55 PFAM
PDB:1BYY|A 1473 1525 5e-29 PDB
Pfam:Ion_trans 1564 1773 8.2e-49 PFAM
Pfam:PKD_channel 1626 1780 2.6e-9 PFAM
IQ 1902 1924 5e-2 SMART
low complexity region 1960 1982 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138934
Meta Mutation Damage Score 0.726 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype Strain: 2179753; 3765977
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene die prenatally usually during organogenesis and may display decreased embryo size and abnormal cardiovascular system physiology. Heterozygous mice typically display abnormal heartbeats and defects in the function of the impulse conduction system. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(9) Gene trapped(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 T C 7: 28,904,619 I406V probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ank1 T A 8: 23,116,098 F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Atp9a C A 2: 168,634,870 V1000L probably benign Het
Bnip3 A G 7: 138,909,304 probably benign Het
Btbd11 T C 10: 85,388,083 V252A unknown Het
Btnl6 T A 17: 34,508,397 R386S probably damaging Het
Calcrl A G 2: 84,375,314 V11A probably benign Het
Cc2d1a G T 8: 84,136,942 A597D possibly damaging Het
Celsr3 A G 9: 108,837,151 T1960A probably benign Het
Cfb T A 17: 34,862,102 probably null Het
Chd8 A G 14: 52,221,071 I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 probably null Het
Crhr2 T A 6: 55,091,292 T428S probably damaging Het
Crybg2 A T 4: 134,092,077 I1753F probably damaging Het
Ctsq A T 13: 61,039,141 V46E probably benign Het
Cxcr1 T C 1: 74,192,281 E194G probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Dpyd T A 3: 119,431,575 M999K probably benign Het
Gbp3 A C 3: 142,567,799 D369A possibly damaging Het
Glmp A G 3: 88,325,188 E36G probably damaging Het
Gm10113 T C 13: 46,177,443 noncoding transcript Het
Gm6486 T A 5: 3,070,846 noncoding transcript Het
Gm973 T G 1: 59,632,350 L891R unknown Het
Heatr3 C T 8: 88,139,954 T8M probably damaging Het
Herc1 A G 9: 66,445,549 M2106V probably damaging Het
Hfm1 A T 5: 106,898,643 probably null Het
Hspa14 A G 2: 3,489,764 V462A possibly damaging Het
Hspa5 C A 2: 34,775,749 T535K possibly damaging Het
Ift140 A G 17: 25,055,589 D745G probably benign Het
Ift27 A T 15: 78,173,781 C8S possibly damaging Het
Irak1bp1 G A 9: 82,846,563 W182* probably null Het
Itga3 A G 11: 95,062,715 I236T probably benign Het
Kctd15 T A 7: 34,650,122 N26Y possibly damaging Het
Kdm1b T C 13: 47,079,253 V733A possibly damaging Het
Lhx8 A T 3: 154,321,703 L234H probably damaging Het
Lrp2 T A 2: 69,506,754 T1225S probably damaging Het
Lrrn1 G A 6: 107,568,527 D429N probably benign Het
Mettl3 A T 14: 52,298,786 N200K possibly damaging Het
Mixl1 G T 1: 180,696,771 A81D possibly damaging Het
Mroh2b T C 15: 4,951,281 I1444T probably benign Het
Muc15 T A 2: 110,731,441 L74* probably null Het
Olfm2 T A 9: 20,668,528 Y317F probably damaging Het
Olfr1468-ps1 G A 19: 13,375,334 S124N probably benign Het
Olfr474 T A 7: 107,954,794 I51N probably benign Het
Olfr622 C T 7: 103,639,679 V154M probably benign Het
Pclo A T 5: 14,713,288 Y3925F unknown Het
Pik3c2g A T 6: 139,622,139 R84S probably damaging Het
Pik3c2g A G 6: 139,896,792 Q449R probably damaging Het
Psg28 T C 7: 18,426,380 E297G probably damaging Het
Qrich2 A T 11: 116,447,006 probably benign Het
Rgs9 A G 11: 109,239,560 I363T probably damaging Het
Rnpepl1 A G 1: 92,916,821 D345G probably damaging Het
Rtn4 T A 11: 29,708,023 F726I probably damaging Het
Sart3 A T 5: 113,755,446 I330N probably damaging Het
Sema4a T C 3: 88,440,701 T438A probably damaging Het
Sfxn1 A C 13: 54,088,942 Y73S probably benign Het
Slc24a2 A G 4: 86,996,645 M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 V656A probably benign Het
Smok2a T G 17: 13,226,134 D199E probably benign Het
Tbc1d10c T C 19: 4,185,031 I344V probably benign Het
Tll1 A T 8: 64,053,891 Y605* probably null Het
Trim75 G A 8: 64,982,883 P305L probably damaging Het
Unc13c T C 9: 73,930,884 N895S probably benign Het
Vmn2r25 A T 6: 123,822,917 I822N probably damaging Het
Wasf3 T G 5: 146,470,356 D495E unknown Het
Wdhd1 T A 14: 47,273,210 K119* probably null Het
Wnt2b T A 3: 104,951,023 D310V probably damaging Het
Zfat G T 15: 68,180,777 D389E probably damaging Het
Zfp282 G A 6: 47,880,168 V112M probably damaging Het
Zfp617 A T 8: 71,933,413 K529I probably damaging Het
Zfp866 A T 8: 69,765,723 C416S probably damaging Het
Zfp991 G A 4: 147,179,765 G533D probably benign Het
Other mutations in Scn5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Scn5a APN 9 119486224 missense probably damaging 1.00
IGL00480:Scn5a APN 9 119517538 missense possibly damaging 0.73
IGL00542:Scn5a APN 9 119492126 missense probably damaging 1.00
IGL00852:Scn5a APN 9 119537682 missense probably benign 0.26
IGL00895:Scn5a APN 9 119513104 splice site probably null
IGL00905:Scn5a APN 9 119536501 missense probably damaging 1.00
IGL01347:Scn5a APN 9 119562441 nonsense probably null
IGL01396:Scn5a APN 9 119534704 missense probably damaging 0.98
IGL01402:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01404:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01487:Scn5a APN 9 119562623 start codon destroyed probably null 0.90
IGL01612:Scn5a APN 9 119486025 missense possibly damaging 0.86
IGL02134:Scn5a APN 9 119485892 missense probably damaging 0.98
IGL02434:Scn5a APN 9 119533793 missense possibly damaging 0.83
IGL02698:Scn5a APN 9 119521097 missense probably damaging 1.00
IGL02717:Scn5a APN 9 119529010 missense probably benign 0.12
IGL02746:Scn5a APN 9 119550637 missense probably damaging 1.00
IGL02951:Scn5a APN 9 119495685 missense probably damaging 1.00
IGL03155:Scn5a APN 9 119512182 missense possibly damaging 0.74
IGL03188:Scn5a APN 9 119522566 missense probably damaging 1.00
IGL03268:Scn5a APN 9 119521231 missense probably damaging 1.00
IGL03287:Scn5a APN 9 119489778 missense probably damaging 1.00
IGL03328:Scn5a APN 9 119537636 missense probably benign 0.12
PIT4142001:Scn5a UTSW 9 119486258 missense probably damaging 1.00
PIT4520001:Scn5a UTSW 9 119534570 missense possibly damaging 0.56
R0026:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0267:Scn5a UTSW 9 119543135 missense probably damaging 0.98
R0313:Scn5a UTSW 9 119534571 missense probably damaging 1.00
R0360:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0364:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0369:Scn5a UTSW 9 119533772 missense probably damaging 0.99
R0512:Scn5a UTSW 9 119550658 missense probably damaging 1.00
R0681:Scn5a UTSW 9 119539640 missense probably damaging 0.96
R1163:Scn5a UTSW 9 119533927 missense probably damaging 1.00
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1530:Scn5a UTSW 9 119495562 missense probably damaging 1.00
R1532:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R1544:Scn5a UTSW 9 119486633 missense probably damaging 1.00
R1588:Scn5a UTSW 9 119521301 missense probably damaging 1.00
R1597:Scn5a UTSW 9 119562497 missense probably damaging 0.99
R1607:Scn5a UTSW 9 119486092 missense probably damaging 1.00
R1657:Scn5a UTSW 9 119562380 missense probably damaging 1.00
R1664:Scn5a UTSW 9 119521177 missense possibly damaging 0.84
R1785:Scn5a UTSW 9 119521129 missense probably damaging 1.00
R1925:Scn5a UTSW 9 119529019 missense probably benign
R1956:Scn5a UTSW 9 119517413 missense possibly damaging 0.82
R2006:Scn5a UTSW 9 119536480 missense probably damaging 1.00
R2061:Scn5a UTSW 9 119485651 missense probably damaging 0.98
R2083:Scn5a UTSW 9 119492123 missense probably benign 0.45
R2180:Scn5a UTSW 9 119516051 missense probably benign
R2216:Scn5a UTSW 9 119485612 missense probably benign 0.37
R2216:Scn5a UTSW 9 119513085 missense probably benign
R2320:Scn5a UTSW 9 119529956 critical splice donor site probably null
R2377:Scn5a UTSW 9 119539727 missense probably damaging 1.00
R2510:Scn5a UTSW 9 119533685 missense probably benign 0.05
R3113:Scn5a UTSW 9 119485672 missense probably damaging 1.00
R3769:Scn5a UTSW 9 119552076 critical splice acceptor site probably benign
R4133:Scn5a UTSW 9 119486372 missense probably damaging 1.00
R4164:Scn5a UTSW 9 119495778 missense probably damaging 1.00
R4447:Scn5a UTSW 9 119550627 missense probably damaging 1.00
R4635:Scn5a UTSW 9 119528985 missense possibly damaging 0.47
R4734:Scn5a UTSW 9 119539538 missense probably damaging 0.98
R4829:Scn5a UTSW 9 119534707 missense probably benign 0.00
R4867:Scn5a UTSW 9 119550671 nonsense probably null
R5055:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R5229:Scn5a UTSW 9 119535976 missense probably damaging 1.00
R5344:Scn5a UTSW 9 119534007 missense probably benign 0.25
R5424:Scn5a UTSW 9 119501734 missense probably damaging 1.00
R5517:Scn5a UTSW 9 119495713 missense probably damaging 1.00
R5526:Scn5a UTSW 9 119521171 missense probably damaging 1.00
R5560:Scn5a UTSW 9 119560286 missense probably damaging 1.00
R5719:Scn5a UTSW 9 119530052 missense possibly damaging 0.91
R5726:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R5800:Scn5a UTSW 9 119501666 missense probably damaging 1.00
R5826:Scn5a UTSW 9 119521333 missense probably damaging 1.00
R6101:Scn5a UTSW 9 119522650 missense probably damaging 0.98
R6162:Scn5a UTSW 9 119522555 missense probably damaging 0.98
R6375:Scn5a UTSW 9 119543356 missense probably damaging 1.00
R6378:Scn5a UTSW 9 119486036 missense probably damaging 1.00
R6464:Scn5a UTSW 9 119534580 missense probably damaging 1.00
R6794:Scn5a UTSW 9 119535889 missense probably damaging 0.98
R6799:Scn5a UTSW 9 119495622 missense possibly damaging 0.62
R6850:Scn5a UTSW 9 119501749 missense possibly damaging 0.92
R6858:Scn5a UTSW 9 119492090 missense probably benign 0.11
R6861:Scn5a UTSW 9 119530023 missense probably damaging 1.00
R6875:Scn5a UTSW 9 119486644 missense probably damaging 1.00
R6989:Scn5a UTSW 9 119486329 missense probably damaging 1.00
R7009:Scn5a UTSW 9 119485930 missense probably damaging 1.00
R7064:Scn5a UTSW 9 119489911 missense probably damaging 0.99
R7145:Scn5a UTSW 9 119486371 missense probably damaging 1.00
R7212:Scn5a UTSW 9 119543385 missense possibly damaging 0.94
R7238:Scn5a UTSW 9 119491544 missense possibly damaging 0.73
R7266:Scn5a UTSW 9 119562560 missense probably benign 0.37
X0023:Scn5a UTSW 9 119517769 missense probably damaging 1.00
X0065:Scn5a UTSW 9 119485669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGAACTCCAAAATTAAGGTG -3'
(R):5'- AAACTTCCTGTTACCTCGGGG -3'

Sequencing Primer
(F):5'- CAGAACTCCAAAATTAAGGTGATTGG -3'
(R):5'- TAGGTTCACCCGGGAGTCAC -3'
Posted On2017-07-14