Incidental Mutation 'R6046:Rgs9'
ID483313
Institutional Source Beutler Lab
Gene Symbol Rgs9
Ensembl Gene ENSMUSG00000020599
Gene Nameregulator of G-protein signaling 9
SynonymsRgs9-2, RGS9-1
MMRRC Submission 044214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6046 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109225355-109298129 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109239560 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 363 (I363T)
Ref Sequence ENSEMBL: ENSMUSP00000102317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020920] [ENSMUST00000103062] [ENSMUST00000106706]
Predicted Effect probably damaging
Transcript: ENSMUST00000020920
AA Change: I363T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020920
Gene: ENSMUSG00000020599
AA Change: I363T

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
low complexity region 486 504 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103062
AA Change: I137T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099351
Gene: ENSMUSG00000020599
AA Change: I137T

DomainStartEndE-ValueType
G_gamma 1 54 2.27e-6 SMART
GGL 1 54 1.86e-15 SMART
RGS 73 188 4.47e-48 SMART
low complexity region 260 278 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106706
AA Change: I363T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102317
Gene: ENSMUSG00000020599
AA Change: I363T

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156785
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, relative to wild-type, homozygous null photoreceptors display abnormally retarded recovery of their light responses, and slowed rates of GTP hydrolysis by transducin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 T C 7: 28,904,619 I406V probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ank1 T A 8: 23,116,098 F1124I probably damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Atp9a C A 2: 168,634,870 V1000L probably benign Het
Bnip3 A G 7: 138,909,304 probably benign Het
Btbd11 T C 10: 85,388,083 V252A unknown Het
Btnl6 T A 17: 34,508,397 R386S probably damaging Het
Calcrl A G 2: 84,375,314 V11A probably benign Het
Cc2d1a G T 8: 84,136,942 A597D possibly damaging Het
Celsr3 A G 9: 108,837,151 T1960A probably benign Het
Cfb T A 17: 34,862,102 probably null Het
Chd8 A G 14: 52,221,071 I860T possibly damaging Het
Col28a1 A G 6: 8,168,102 probably null Het
Crhr2 T A 6: 55,091,292 T428S probably damaging Het
Crybg2 A T 4: 134,092,077 I1753F probably damaging Het
Ctsq A T 13: 61,039,141 V46E probably benign Het
Cxcr1 T C 1: 74,192,281 E194G probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Dpyd T A 3: 119,431,575 M999K probably benign Het
Gbp3 A C 3: 142,567,799 D369A possibly damaging Het
Glmp A G 3: 88,325,188 E36G probably damaging Het
Gm10113 T C 13: 46,177,443 noncoding transcript Het
Gm6486 T A 5: 3,070,846 noncoding transcript Het
Gm973 T G 1: 59,632,350 L891R unknown Het
Heatr3 C T 8: 88,139,954 T8M probably damaging Het
Herc1 A G 9: 66,445,549 M2106V probably damaging Het
Hfm1 A T 5: 106,898,643 probably null Het
Hspa14 A G 2: 3,489,764 V462A possibly damaging Het
Hspa5 C A 2: 34,775,749 T535K possibly damaging Het
Ift140 A G 17: 25,055,589 D745G probably benign Het
Ift27 A T 15: 78,173,781 C8S possibly damaging Het
Irak1bp1 G A 9: 82,846,563 W182* probably null Het
Itga3 A G 11: 95,062,715 I236T probably benign Het
Kctd15 T A 7: 34,650,122 N26Y possibly damaging Het
Kdm1b T C 13: 47,079,253 V733A possibly damaging Het
Lhx8 A T 3: 154,321,703 L234H probably damaging Het
Lrp2 T A 2: 69,506,754 T1225S probably damaging Het
Lrrn1 G A 6: 107,568,527 D429N probably benign Het
Mettl3 A T 14: 52,298,786 N200K possibly damaging Het
Mixl1 G T 1: 180,696,771 A81D possibly damaging Het
Mroh2b T C 15: 4,951,281 I1444T probably benign Het
Muc15 T A 2: 110,731,441 L74* probably null Het
Olfm2 T A 9: 20,668,528 Y317F probably damaging Het
Olfr1468-ps1 G A 19: 13,375,334 S124N probably benign Het
Olfr474 T A 7: 107,954,794 I51N probably benign Het
Olfr622 C T 7: 103,639,679 V154M probably benign Het
Pclo A T 5: 14,713,288 Y3925F unknown Het
Pik3c2g A T 6: 139,622,139 R84S probably damaging Het
Pik3c2g A G 6: 139,896,792 Q449R probably damaging Het
Psg28 T C 7: 18,426,380 E297G probably damaging Het
Qrich2 A T 11: 116,447,006 probably benign Het
Rnpepl1 A G 1: 92,916,821 D345G probably damaging Het
Rtn4 T A 11: 29,708,023 F726I probably damaging Het
Sart3 A T 5: 113,755,446 I330N probably damaging Het
Scn5a T C 9: 119,562,374 D84G probably damaging Het
Sema4a T C 3: 88,440,701 T438A probably damaging Het
Sfxn1 A C 13: 54,088,942 Y73S probably benign Het
Slc24a2 A G 4: 86,996,645 M585T probably damaging Het
Slc26a7 A G 4: 14,505,471 V656A probably benign Het
Smok2a T G 17: 13,226,134 D199E probably benign Het
Tbc1d10c T C 19: 4,185,031 I344V probably benign Het
Tll1 A T 8: 64,053,891 Y605* probably null Het
Trim75 G A 8: 64,982,883 P305L probably damaging Het
Unc13c T C 9: 73,930,884 N895S probably benign Het
Vmn2r25 A T 6: 123,822,917 I822N probably damaging Het
Wasf3 T G 5: 146,470,356 D495E unknown Het
Wdhd1 T A 14: 47,273,210 K119* probably null Het
Wnt2b T A 3: 104,951,023 D310V probably damaging Het
Zfat G T 15: 68,180,777 D389E probably damaging Het
Zfp282 G A 6: 47,880,168 V112M probably damaging Het
Zfp617 A T 8: 71,933,413 K529I probably damaging Het
Zfp866 A T 8: 69,765,723 C416S probably damaging Het
Zfp991 G A 4: 147,179,765 G533D probably benign Het
Other mutations in Rgs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Rgs9 APN 11 109249049 splice site probably benign
IGL01949:Rgs9 APN 11 109259834 critical splice donor site probably null
IGL02479:Rgs9 APN 11 109225652 missense possibly damaging 0.51
IGL03170:Rgs9 APN 11 109259855 missense probably benign 0.10
R1368:Rgs9 UTSW 11 109248151 missense probably benign 0.00
R1499:Rgs9 UTSW 11 109268921 critical splice donor site probably null
R1780:Rgs9 UTSW 11 109239499 nonsense probably null
R2422:Rgs9 UTSW 11 109225777 critical splice acceptor site probably null
R2509:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2510:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2511:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R3932:Rgs9 UTSW 11 109275813 splice site probably benign
R4179:Rgs9 UTSW 11 109281448 critical splice donor site probably null
R4801:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4802:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4928:Rgs9 UTSW 11 109225744 missense probably benign 0.08
R5073:Rgs9 UTSW 11 109227331 missense probably benign 0.03
R5209:Rgs9 UTSW 11 109239594 critical splice acceptor site probably null
R5286:Rgs9 UTSW 11 109239451 splice site probably null
R5449:Rgs9 UTSW 11 109225744 missense probably benign
R6267:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R6296:Rgs9 UTSW 11 109268987 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTGGTAACTGTGAAGGGG -3'
(R):5'- GCTTGCTCTCCTAGAACATCAAG -3'

Sequencing Primer
(F):5'- TAACTGTGAAGGGGGCTCC -3'
(R):5'- CTTATCCTGGCATCTGGGAAAAGC -3'
Posted On2017-07-14