Incidental Mutation 'R6047:Cdk9'
ID 483331
Institutional Source Beutler Lab
Gene Symbol Cdk9
Ensembl Gene ENSMUSG00000009555
Gene Name cyclin dependent kinase 9
Synonyms PITALRE
MMRRC Submission 044215-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6047 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 32595796-32603088 bp(-) (GRCm39)
Type of Mutation splice site (1885 bp from exon)
DNA Base Change (assembly) T to C at 32598285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009699] [ENSMUST00000120105] [ENSMUST00000123170] [ENSMUST00000127812] [ENSMUST00000146498] [ENSMUST00000154131] [ENSMUST00000143743] [ENSMUST00000155205]
AlphaFold Q99J95
Predicted Effect probably benign
Transcript: ENSMUST00000009699
AA Change: D257G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000009699
Gene: ENSMUSG00000009555
AA Change: D257G

DomainStartEndE-ValueType
S_TKc 19 315 9.28e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120105
AA Change: D206G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113327
Gene: ENSMUSG00000009555
AA Change: D206G

DomainStartEndE-ValueType
Pfam:Pkinase 1 264 9.8e-58 PFAM
Pfam:Pkinase_Tyr 2 215 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125058
Predicted Effect probably benign
Transcript: ENSMUST00000127812
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198213
Predicted Effect probably benign
Transcript: ENSMUST00000146498
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154131
SMART Domains Protein: ENSMUSP00000120857
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 19 61 8.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143743
Predicted Effect probably null
Transcript: ENSMUST00000155205
SMART Domains Protein: ENSMUSP00000115299
Gene: ENSMUSG00000009555

DomainStartEndE-ValueType
Pfam:Pkinase 1 54 8.4e-7 PFAM
Meta Mutation Damage Score 0.1281 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,856,066 (GRCm39) I58T probably damaging Het
Adgrb2 G T 4: 129,912,498 (GRCm39) G1208C probably damaging Het
Antxrl T C 14: 33,775,433 (GRCm39) probably benign Het
Appl2 C T 10: 83,448,765 (GRCm39) probably null Het
Bloc1s2 T C 19: 44,130,629 (GRCm39) I112V possibly damaging Het
Cblb G T 16: 51,932,611 (GRCm39) probably null Het
Dok7 G A 5: 35,236,651 (GRCm39) G206D probably damaging Het
Ftsj3 C T 11: 106,143,144 (GRCm39) R390H probably damaging Het
Gpr179 G T 11: 97,229,242 (GRCm39) P971Q probably damaging Het
Hic1 A T 11: 75,057,675 (GRCm39) S405T possibly damaging Het
Ifngr1 T C 10: 19,482,061 (GRCm39) L217P probably damaging Het
Insrr A G 3: 87,711,483 (GRCm39) K468E probably damaging Het
Lce1j G C 3: 92,696,503 (GRCm39) R92G unknown Het
Lrp12 T C 15: 39,735,463 (GRCm39) E823G probably damaging Het
Lrp1b A G 2: 40,527,787 (GRCm39) I98T probably benign Het
Mbd3l2 A T 9: 18,356,212 (GRCm39) H179L possibly damaging Het
Med24 A T 11: 98,598,591 (GRCm39) C691* probably null Het
Mical1 T C 10: 41,357,703 (GRCm39) probably null Het
Msantd2 A T 9: 37,434,738 (GRCm39) Y326F probably damaging Het
Nfyc T A 4: 120,636,314 (GRCm39) probably null Het
Nrg3 T A 14: 38,119,309 (GRCm39) probably null Het
Nt5c3 G A 6: 56,859,964 (GRCm39) S291L probably damaging Het
Pak4 A G 7: 28,262,461 (GRCm39) Y384H probably benign Het
Pdia5 T C 16: 35,217,848 (GRCm39) K512E probably damaging Het
Pfpl T C 19: 12,406,597 (GRCm39) F283L probably damaging Het
Pick1 A G 15: 79,139,895 (GRCm39) probably benign Het
Pkd1 T C 17: 24,814,059 (GRCm39) V4143A probably damaging Het
Ptprc C T 1: 138,028,779 (GRCm39) probably null Het
Scn10a A G 9: 119,451,897 (GRCm39) F1342S probably benign Het
Slc17a7 A T 7: 44,822,830 (GRCm39) I436F probably benign Het
Slc34a1 G T 13: 55,559,884 (GRCm39) A403S probably damaging Het
Stmn3 A T 2: 180,950,952 (GRCm39) Y35N possibly damaging Het
Tldc2 A G 2: 156,938,382 (GRCm39) E207G probably damaging Het
Unc79 A G 12: 103,027,717 (GRCm39) N436S probably damaging Het
Uty G T Y: 1,158,288 (GRCm39) P538Q probably damaging Het
Zzef1 A G 11: 72,756,921 (GRCm39) D1142G probably damaging Het
Other mutations in Cdk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Cdk9 APN 2 32,598,063 (GRCm39) missense possibly damaging 0.77
R0321:Cdk9 UTSW 2 32,602,698 (GRCm39) unclassified probably benign
R0615:Cdk9 UTSW 2 32,599,813 (GRCm39) missense possibly damaging 0.92
R0624:Cdk9 UTSW 2 32,599,836 (GRCm39) missense probably damaging 1.00
R0661:Cdk9 UTSW 2 32,599,832 (GRCm39) missense probably damaging 1.00
R1525:Cdk9 UTSW 2 32,600,521 (GRCm39) missense probably damaging 0.97
R2082:Cdk9 UTSW 2 32,599,513 (GRCm39) missense probably damaging 1.00
R4416:Cdk9 UTSW 2 32,598,084 (GRCm39) missense probably damaging 1.00
R7391:Cdk9 UTSW 2 32,602,083 (GRCm39) missense probably damaging 0.96
R8127:Cdk9 UTSW 2 32,598,009 (GRCm39) missense probably benign
R8792:Cdk9 UTSW 2 32,598,269 (GRCm39) missense probably benign 0.12
R9040:Cdk9 UTSW 2 32,597,999 (GRCm39) missense probably benign
R9231:Cdk9 UTSW 2 32,598,006 (GRCm39) missense probably benign 0.00
R9238:Cdk9 UTSW 2 32,598,273 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCAGAAGAAGTCGTGGTTG -3'
(R):5'- GCACATTTATCGCAGCTGAC -3'

Sequencing Primer
(F):5'- TGAGGGCATCGTCACTGTCAATC -3'
(R):5'- ACATTTATCGCAGCTGACTTGTG -3'
Posted On 2017-07-14