Incidental Mutation 'R6049:Rbck1'
ID483429
Institutional Source Beutler Lab
Gene Symbol Rbck1
Ensembl Gene ENSMUSG00000027466
Gene NameRanBP-type and C3HC4-type zinc finger containing 1
SynonymsHOIL-1, HOIL-1L, Ubce7ip3
MMRRC Submission 044217-MU
Accession Numbers

Genbank: NM_001083921; MGI: 1344372

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6049 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location152316334-152332653 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 152323174 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 85 (C85*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028964] [ENSMUST00000109847]
Predicted Effect probably null
Transcript: ENSMUST00000028964
AA Change: C303*
SMART Domains Protein: ENSMUSP00000028964
Gene: ENSMUSG00000027466
AA Change: C303*

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Pfam:IBR 346 409 1.5e-9 PFAM
Pfam:IBR 422 483 2.5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109847
AA Change: C303*
SMART Domains Protein: ENSMUSP00000105473
Gene: ENSMUSG00000027466
AA Change: C303*

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Blast:IBR 427 507 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131889
Predicted Effect probably null
Transcript: ENSMUST00000144865
AA Change: C85*
SMART Domains Protein: ENSMUSP00000118592
Gene: ENSMUSG00000027466
AA Change: C85*

DomainStartEndE-ValueType
coiled coil region 13 41 N/A INTRINSIC
RING 63 107 2.67e-5 SMART
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145889
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased TNF-induced hepatocyte apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik G A 4: 103,231,323 H229Y probably benign Het
Abcd2 A G 15: 91,178,236 F500L probably benign Het
Adgb A G 10: 10,378,026 L1190P probably damaging Het
Adgrv1 A G 13: 81,397,354 V5604A probably benign Het
Ank2 T A 3: 126,943,020 T3072S possibly damaging Het
Arhgap39 A G 15: 76,727,401 probably null Het
C6 T C 15: 4,735,172 C117R probably damaging Het
Cacna1a A G 8: 84,638,846 E2206G probably damaging Het
Cd2bp2 A T 7: 127,193,835 F338L probably damaging Het
Cngb1 T C 8: 95,270,842 D575G probably damaging Het
Crat A G 2: 30,403,541 F63S probably damaging Het
Crybg3 T C 16: 59,544,054 T2402A probably benign Het
Ctsq A G 13: 61,038,758 probably null Het
Cux1 T C 5: 136,332,710 R248G probably damaging Het
D7Ertd443e T C 7: 134,298,232 H420R probably benign Het
Deup1 A G 9: 15,561,256 F587L possibly damaging Het
Dnah6 T C 6: 73,086,166 K2651R probably benign Het
Dnah7b A G 1: 46,085,602 I144V probably benign Het
Dnajc1 T C 2: 18,231,700 probably null Het
Fscb T C 12: 64,474,320 N124S possibly damaging Het
Gabbr2 A G 4: 46,787,641 Y341H probably damaging Het
Gm5538 A C 3: 59,752,149 D341A probably damaging Het
Greb1 T A 12: 16,681,394 I1648F probably damaging Het
Hace1 A T 10: 45,686,662 N758Y probably damaging Het
Irs2 A C 8: 11,006,805 D542E probably benign Het
Kat6a T A 8: 22,939,037 H1469Q possibly damaging Het
Kif15 G A 9: 123,011,622 R36K probably damaging Het
Krt42 C T 11: 100,267,060 V193M probably damaging Het
Limch1 A T 5: 67,030,860 E878V probably benign Het
Med18 G T 4: 132,459,713 D158E probably benign Het
Med6 T C 12: 81,591,323 N38S probably damaging Het
Mup13 T C 4: 61,227,597 T76A probably benign Het
Nlrp4b T A 7: 10,714,713 L281* probably null Het
Olfr191 A T 16: 59,086,146 C112* probably null Het
Olfr823 A T 10: 130,112,612 H59Q probably benign Het
Olfr846 C A 9: 19,361,344 G4* probably null Het
Pde4d A T 13: 109,032,585 R54* probably null Het
Pdpk1 A T 17: 24,098,135 Y251* probably null Het
Pdzk1 A G 3: 96,851,663 E128G probably benign Het
Phf12 A G 11: 78,028,170 probably null Het
Pnliprp2 A G 19: 58,760,452 E63G possibly damaging Het
Prkcd T C 14: 30,607,297 E62G possibly damaging Het
Prl7b1 G T 13: 27,606,178 D77E probably benign Het
Rfx3 A T 19: 27,802,395 M481K probably damaging Het
Rmdn3 A G 2: 119,153,425 F159L probably damaging Het
Rpusd3 A C 6: 113,417,841 probably null Het
Rsg1 T A 4: 141,218,162 V108D probably benign Het
Ska1 T C 18: 74,202,600 T100A probably benign Het
Slc1a3 T C 15: 8,645,693 E276G probably damaging Het
Slc27a6 T A 18: 58,598,660 Y361N probably damaging Het
Smc1b A G 15: 85,121,695 L336S probably damaging Het
St7 A G 6: 17,694,348 D46G possibly damaging Het
Supt5 A G 7: 28,315,197 I1059T probably benign Het
Syne1 A T 10: 5,347,926 S1124T possibly damaging Het
Szt2 A G 4: 118,402,988 S54P probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tbc1d7 A C 13: 43,159,360 M19R probably damaging Het
Tbpl2 T C 2: 24,094,992 N47D possibly damaging Het
Tgfbr3 C T 5: 107,118,485 A790T probably damaging Het
Tmem2 A T 19: 21,826,126 Q841L probably benign Het
Tnr T C 1: 159,912,754 V1166A probably damaging Het
Ttn G A 2: 76,846,310 probably benign Het
Other mutations in Rbck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Rbck1 APN 2 152318395 missense probably damaging 0.98
IGL00765:Rbck1 APN 2 152330954 splice site probably benign
IGL01647:Rbck1 APN 2 152323232 missense probably damaging 1.00
IGL01945:Rbck1 APN 2 152318316 missense probably damaging 1.00
IGL02141:Rbck1 APN 2 152318374 missense possibly damaging 0.56
IGL02573:Rbck1 APN 2 152322167 missense possibly damaging 0.90
IGL02950:Rbck1 APN 2 152331077 missense possibly damaging 0.95
green_fire UTSW 2 152323174 nonsense probably null
iron_throne UTSW 2 152318451 missense probably benign 0.45
Viserion UTSW 2 152330966 missense possibly damaging 0.87
westeros UTSW 2 152318733 nonsense probably null
A4554:Rbck1 UTSW 2 152319172 missense probably damaging 1.00
R0532:Rbck1 UTSW 2 152324330 missense probably damaging 0.99
R1426:Rbck1 UTSW 2 152327241 unclassified probably benign
R1598:Rbck1 UTSW 2 152323170 critical splice donor site probably null
R1666:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1668:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1889:Rbck1 UTSW 2 152318356 missense probably damaging 0.99
R4572:Rbck1 UTSW 2 152318733 nonsense probably null
R4592:Rbck1 UTSW 2 152318733 nonsense probably null
R5077:Rbck1 UTSW 2 152318451 missense probably benign 0.45
R6494:Rbck1 UTSW 2 152330966 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTTGGATTCTCTGAGCCTAGTC -3'
(R):5'- TGACCAACTGAGACCCTGAC -3'

Sequencing Primer
(F):5'- GGCTGGCTTGAACTCACTATACAG -3'
(R):5'- ACTGAGACCCTGACCCTCCTG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

PCR Primers

R6049-Rbck1_PCR_F: 5’- CTTGGATTCTCTGAGCCTAGTC-3’

R6049-Rbck1_PCR_R: 5’- TGACCAACTGAGACCCTGAC-3’

 

Sequencing Primers

R6049-Rbck1_SEQ_F: 5’- GGCTGGCTTGAACTCACTATACAG-3’
 

R6049-Rbck1_SEQ_R: 5’- ACTGAGACCCTGACCCTCCTG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 483 nucleotides is amplified:

cttggattct ctgagcctag tctttctttt ttctgatttt ggagacaagg tctcaagcag       

ccctggctgg cttgaactca ctatacagcc gaagctagtc ttgaacgtct gatcctcctg      

cctccagctc ctgagagctg ggatttcagg cataagccac aataactctt gcataaacag      

tgttttgtgg gcatccaatg agataaggaa caaggccaca gacattttac tctggtaaca      

ctgtcactgg gtgggagtgg ggccgcacct gcagaaggtg tgcagacact cacgcagcac      

cacggcctcg ccgggtgcca gcactgagta gcacacaggg cactcagtag gttcggtgtt      

cagcaccagg ctcctctgct ccagctgcac gtgctgcagg tagttcccct cctgctgctg      

ctgtttccgc tgggcacatg ggcagggcgg ggccaccagg agggtcaggg tctcagttgg      

tca

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = G>T).

Posted On2017-07-14