Incidental Mutation 'R6050:Prcc'
ID483492
Institutional Source Beutler Lab
Gene Symbol Prcc
Ensembl Gene ENSMUSG00000004895
Gene Namepapillary renal cell carcinoma (translocation-associated)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R6050 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location87858903-87885608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87869884 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 261 (T261I)
Ref Sequence ENSEMBL: ENSMUSP00000005015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005015]
Predicted Effect probably damaging
Transcript: ENSMUST00000005015
AA Change: T261I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005015
Gene: ENSMUSG00000004895
AA Change: T261I

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
low complexity region 42 95 N/A INTRINSIC
low complexity region 101 136 N/A INTRINSIC
low complexity region 229 258 N/A INTRINSIC
Pfam:PRCC 275 490 7.2e-62 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in pre-mRNA splicing. Chromosomal translocations (X;1)(p11;q21) that result in fusion of this gene to TFE3 (GeneID 7030) have been associated with papillary renal cell carcinoma. A PRCC-TFE3 fusion protein is expressed in affected carcinomas and is likely associated with altered gene transactivation. This fusion protein has also been associated with disruption of the cell cycle.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ahdc1 A G 4: 133,065,891 D1481G possibly damaging Het
Ak9 A G 10: 41,389,112 E955G possibly damaging Het
Aox3 T C 1: 58,180,655 F1138S possibly damaging Het
Bbs2 T A 8: 94,092,532 N70Y probably damaging Het
BC048679 T C 7: 81,495,591 I70V possibly damaging Het
Ccdc141 G T 2: 77,011,731 A1452E probably benign Het
Celsr1 T C 15: 85,930,611 D1883G probably benign Het
Clhc1 A G 11: 29,561,397 I280M possibly damaging Het
Cmtr1 G T 17: 29,682,134 K678N probably damaging Het
Daam2 T C 17: 49,486,502 D329G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Fcf1 G A 12: 84,982,243 C154Y probably damaging Het
Frem2 T C 3: 53,653,012 N1358S probably damaging Het
Gm16432 G A 1: 178,103,924 A470T unknown Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtf3c3 T C 1: 54,406,070 I608M probably benign Het
Gzf1 G A 2: 148,684,238 D210N possibly damaging Het
Ift140 C T 17: 25,091,005 R1129C probably damaging Het
Lias A G 5: 65,393,972 I83V possibly damaging Het
Mgea5 A C 19: 45,765,480 S652A possibly damaging Het
Mlh3 T C 12: 85,240,846 T1342A possibly damaging Het
Mn1 A G 5: 111,419,397 Y411C probably damaging Het
Mrps21 C T 3: 95,862,888 R43H probably benign Het
Ncam2 C T 16: 81,443,166 Q172* probably null Het
Notch3 T C 17: 32,143,527 T1375A probably benign Het
Ovol3 T A 7: 30,234,394 Y101F probably benign Het
Pcbp4 T C 9: 106,462,223 V45A probably benign Het
Plec T C 15: 76,188,258 E709G probably damaging Het
Psg25 A G 7: 18,526,478 V165A probably benign Het
Rfk C T 19: 17,399,532 P133S probably benign Het
Scaf8 C T 17: 3,168,108 T251M unknown Het
Sec14l2 T C 11: 4,111,477 D67G probably benign Het
Smtnl1 A G 2: 84,811,453 I441T probably damaging Het
Tbce C T 13: 13,998,434 V471I possibly damaging Het
Tnip1 G A 11: 54,917,877 R495C probably damaging Het
Trbv19 A G 6: 41,179,010 K105R probably benign Het
Ttc5 T A 14: 50,773,287 N229I probably damaging Het
Ush2a T C 1: 188,957,324 F5028L probably benign Het
Vmn2r24 T C 6: 123,815,732 S673P probably damaging Het
Zfp780b A T 7: 27,964,302 I276N probably damaging Het
Other mutations in Prcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Prcc APN 3 87872208 critical splice donor site probably null
IGL01314:Prcc APN 3 87870080 missense probably damaging 0.99
IGL01511:Prcc APN 3 87872241 missense probably damaging 1.00
IGL02517:Prcc APN 3 87869677 missense probably damaging 1.00
R4375:Prcc UTSW 3 87867407 missense probably damaging 1.00
R4376:Prcc UTSW 3 87867407 missense probably damaging 1.00
R4377:Prcc UTSW 3 87867407 missense probably damaging 1.00
R5015:Prcc UTSW 3 87872253 missense probably damaging 1.00
R6259:Prcc UTSW 3 87862147 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCGCCATCTTAAACTCAAGGGG -3'
(R):5'- AAAGAGACTAACAGGTTGCTCC -3'

Sequencing Primer
(F):5'- GAAAGCTGGTTCTGGTTC -3'
(R):5'- AGGTTGCTCCTGCCCCATG -3'
Posted On2017-07-14