Incidental Mutation 'R6041:Derl3'
ID483559
Institutional Source Beutler Lab
Gene Symbol Derl3
Ensembl Gene ENSMUSG00000009092
Gene NameDer1-like domain family, member 3
Synonyms1810063P04Rik, 1810006I20Rik, IZP6, derlin-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6041 (G1)
Quality Score151.008
Status Validated
Chromosome10
Chromosomal Location75893413-75895941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75893501 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 26 (L26P)
Ref Sequence ENSEMBL: ENSMUSP00000151623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000925] [ENSMUST00000009236] [ENSMUST00000121304] [ENSMUST00000140388] [ENSMUST00000217811]
Predicted Effect probably benign
Transcript: ENSMUST00000000925
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000009236
AA Change: L26P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009236
Gene: ENSMUSG00000009092
AA Change: L26P

DomainStartEndE-ValueType
Pfam:DER1 13 203 7.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121304
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133189
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140408
Predicted Effect probably damaging
Transcript: ENSMUST00000217811
AA Change: L26P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220190
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in the degradation of misfolded glycoproteins in the ER. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for this gene trapped allele show no obvious phenotype alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Cacna1d A T 14: 30,042,357 S2086T probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Flg2 T A 3: 93,220,361 D173E probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gfm2 T A 13: 97,172,623 V612E probably benign Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Lrrk1 T C 7: 66,262,133 D1893G probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Scrib C T 15: 76,067,172 R159Q possibly damaging Het
Senp1 C T 15: 98,058,216 E441K probably damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Them4 A T 3: 94,317,499 D61V possibly damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Derl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02735:Derl3 APN 10 75895116 missense probably damaging 0.97
IGL03143:Derl3 APN 10 75894490 missense possibly damaging 0.90
R0730:Derl3 UTSW 10 75895242 splice site probably benign
R4819:Derl3 UTSW 10 75893879 intron probably null
R5524:Derl3 UTSW 10 75894490 missense possibly damaging 0.90
R6914:Derl3 UTSW 10 75894216 intron probably null
Predicted Primers PCR Primer
(F):5'- GTCAAACGATTGGCCACAAC -3'
(R):5'- AACTTCCGGAACACCAGGTG -3'

Sequencing Primer
(F):5'- GGACTTCCCCATTGGCTAG -3'
(R):5'- AACACCAGGTGCGGGTTG -3'
Posted On2017-07-14