Incidental Mutation 'R6041:Cacna1d'
ID483573
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 044209-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R6041 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30042357 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2086 (S2086T)
Ref Sequence ENSEMBL: ENSMUSP00000153250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000118917] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably benign
Transcript: ENSMUST00000067620
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: S2051T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: S2051T

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: S2073T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: S2073T

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118917
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223573
Predicted Effect probably damaging
Transcript: ENSMUST00000223803
AA Change: S2051T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: S2086T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: S2042T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225717
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,380 M297K probably damaging Het
Ace A C 11: 105,975,308 H34P probably benign Het
Agbl2 A T 2: 90,808,027 N652I probably benign Het
Auh T A 13: 52,919,086 L86F possibly damaging Het
Bmp10 A G 6: 87,434,320 K365R probably damaging Het
Calcoco1 C A 15: 102,717,939 R105L possibly damaging Het
Casc3 T G 11: 98,828,559 V509G probably damaging Het
Clmn A G 12: 104,781,872 V472A probably benign Het
Cyp2b19 A T 7: 26,759,427 S142C probably damaging Het
Derl3 T C 10: 75,893,501 L26P probably damaging Het
Dgkh C T 14: 78,587,627 A863T probably damaging Het
Dhx30 C T 9: 110,084,598 R1127Q probably benign Het
Dmxl2 A G 9: 54,416,753 S1116P probably damaging Het
Dnah7b T C 1: 46,289,645 V3179A probably benign Het
Dnajb11 A T 16: 22,868,721 N156I probably benign Het
Dpep1 A T 8: 123,200,655 E316V probably damaging Het
F2rl2 T A 13: 95,701,109 F221I probably benign Het
Fam189a2 A T 19: 23,984,829 M270K probably benign Het
Flg2 T A 3: 93,220,361 D173E probably benign Het
Fshr A T 17: 88,985,986 D421E probably damaging Het
Gfm2 T A 13: 97,172,623 V612E probably benign Het
Gm17655 T G 5: 110,047,573 K114N possibly damaging Het
Gm45844 C A 7: 7,278,184 probably benign Het
Gm5724 A C 6: 141,739,038 D230E probably benign Het
Gpr142 A T 11: 114,806,377 I250F probably damaging Het
Hexa A G 9: 59,563,236 Q447R probably damaging Het
Leng8 T C 7: 4,145,569 L780P probably benign Het
Lrrk1 T C 7: 66,262,133 D1893G probably benign Het
Macf1 T A 4: 123,513,848 I139F probably damaging Het
Megf10 A T 18: 57,180,549 T22S probably benign Het
Mup-ps1 C A 4: 60,088,549 noncoding transcript Het
Myh13 A T 11: 67,364,730 E1642V probably damaging Het
Myof A G 19: 37,924,620 Y1462H probably damaging Het
Nipbl T A 15: 8,324,264 D1765V probably damaging Het
Npy5r A T 8: 66,682,023 N39K possibly damaging Het
Olfr1026 G A 2: 85,923,391 G41D probably damaging Het
Pax6 A G 2: 105,683,902 I29V probably damaging Het
Pi4ka A G 16: 17,360,572 Y307H probably benign Het
Pmf1 A C 3: 88,396,051 Y68D probably damaging Het
Psen2 C A 1: 180,245,727 E10* probably null Het
Ptprs T A 17: 56,419,080 M991L probably benign Het
R3hdm4 A G 10: 79,913,661 V20A possibly damaging Het
Rad17 T C 13: 100,617,766 N649D probably benign Het
Rad9b A T 5: 122,351,352 C38S probably damaging Het
Rapgef2 T C 3: 79,069,162 M1296V probably benign Het
Rbp3 T C 14: 33,956,482 S796P probably damaging Het
Rpl10-ps3 A G 9: 50,344,782 S54P probably benign Het
Sclt1 T A 3: 41,627,177 I688F probably damaging Het
Scn10a A G 9: 119,609,469 I1778T probably damaging Het
Scrib C T 15: 76,067,172 R159Q possibly damaging Het
Senp1 C T 15: 98,058,216 E441K probably damaging Het
Sipa1l1 T A 12: 82,342,250 F417I probably damaging Het
Smcr8 A G 11: 60,779,568 D514G probably damaging Het
Tbc1d23 T G 16: 57,173,150 D551A probably benign Het
Tet1 G T 10: 62,813,373 T149N probably damaging Het
Them4 A T 3: 94,317,499 D61V possibly damaging Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trank1 A G 9: 111,377,796 I1666V possibly damaging Het
Vipr2 A C 12: 116,142,984 N378T probably damaging Het
Zfp804b T C 5: 6,771,231 R575G probably benign Het
Zfp941 A T 7: 140,812,245 C400* probably null Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
brisk UTSW 14 30171314 missense possibly damaging 0.91
troppo UTSW 14 30123454 missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 30178645 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7534:Cacna1d UTSW 14 30079362 missense not run
Predicted Primers PCR Primer
(F):5'- AATCATCTCATCTGCCAGGTC -3'
(R):5'- TTGTGGAGCCACTCAGCTTTC -3'

Sequencing Primer
(F):5'- AAAGTCCTGGAGCTCATAGTCCTG -3'
(R):5'- TTTCGACACCAACAGAGCTGAG -3'
Posted On2017-07-14