Incidental Mutation 'R0519:Colgalt2'
ID48362
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Namecollagen beta(1-O)galactosyltransferase 2
SynonymsGlt25d2
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0519 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location152399830-152510695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 152508561 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 551 (A551S)
Ref Sequence ENSEMBL: ENSMUSP00000037532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044311
AA Change: A551S

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: A551S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127586
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152506878 missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152508730 missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152473108 missense probably damaging 1.00
R0409:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0412:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152484871 missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152471813 splice site probably benign
R0605:Colgalt2 UTSW 1 152495792 splice site probably benign
R0628:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152503017 missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152504153 missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152484904 missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152484952 missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152400363 missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152468550 missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152508611 nonsense probably null
R3917:Colgalt2 UTSW 1 152508611 nonsense probably null
R4250:Colgalt2 UTSW 1 152489887 missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152468531 missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152485012 missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152506876 missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152400343 missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152489876 missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152484998 missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152499959 missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152484869 missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152400303 missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152504122 missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152471798 missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152506828 missense probably damaging 1.00
X0028:Colgalt2 UTSW 1 152471720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCCAGGCAGTTTCAGAGATGAC -3'
(R):5'- CAGACAGTGATGAACCTTGCAGACC -3'

Sequencing Primer
(F):5'- CAGTTTCAGAGATGACAAGCAG -3'
(R):5'- TCTTGAAGGCACAGTGTCCAG -3'
Posted On2013-06-12