Incidental Mutation 'R6042:Actn1'
ID483627
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
MMRRC Submission 044210-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R6042 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80177249 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 478 (K478M)
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably benign
Transcript: ENSMUST00000021554
AA Change: K478M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: K478M

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167327
AA Change: K478M

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: K478M

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar G T 1: 72,674,054 S474* probably null Het
Barx2 C A 9: 31,846,903 E246D probably benign Het
Cdh7 A T 1: 110,138,267 Q757L probably damaging Het
Cnr1 T C 4: 33,944,751 F380L probably damaging Het
Cntnap5b G A 1: 100,390,592 A655T probably benign Het
Col2a1 T A 15: 98,000,570 probably benign Het
Crybg3 C T 16: 59,550,475 R2340Q possibly damaging Het
Ctsb G T 14: 63,141,856 D306Y probably damaging Het
Cyp2a22 A C 7: 26,934,239 Y349D probably damaging Het
Dcpp2 T C 17: 23,898,912 L22S probably damaging Het
Dnah8 G T 17: 30,747,265 M2476I probably damaging Het
Dst A G 1: 34,188,972 E1882G probably damaging Het
Esrp1 T C 4: 11,357,580 K511E possibly damaging Het
Fat3 T A 9: 16,377,817 T137S probably benign Het
Fbxw24 T A 9: 109,607,011 M318L probably benign Het
Fpr-rs7 T A 17: 20,113,215 T338S probably benign Het
Gcgr T C 11: 120,534,758 M1T probably null Het
Gm13101 G T 4: 143,966,061 D123E probably benign Het
Grifin C A 5: 140,563,556 R135L possibly damaging Het
Helz T C 11: 107,614,120 probably null Het
Hivep3 C G 4: 120,097,864 Q1126E possibly damaging Het
Htr3a T A 9: 48,904,699 H146L probably damaging Het
Lama3 T A 18: 12,574,254 V3081E probably damaging Het
Mgat5 T A 1: 127,459,899 C531S probably damaging Het
Micalcl A G 7: 112,380,412 D106G probably benign Het
Nectin2 C T 7: 19,738,138 A109T probably benign Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr887 T A 9: 38,085,094 V86E probably damaging Het
Olig3 T C 10: 19,356,755 S43P probably damaging Het
Pcdh12 T C 18: 38,281,505 R856G probably damaging Het
Phpt1 T A 2: 25,574,839 M1L probably benign Het
Polr2m T C 9: 71,483,798 I41V probably damaging Het
Pzp A G 6: 128,524,014 V127A possibly damaging Het
Rgs7 G T 1: 175,149,660 T126K probably damaging Het
RP23-399J5.1 T C 8: 71,089,927 noncoding transcript Het
Rras A T 7: 45,020,396 D112V probably damaging Het
Sdcbp2 T A 2: 151,582,726 Y5* probably null Het
Slc43a2 T C 11: 75,570,607 F462L probably damaging Het
Smchd1 T A 17: 71,377,057 K1436* probably null Het
Snrnp27 A C 6: 86,682,920 S31A unknown Het
Sqstm1 A C 11: 50,207,424 F172V probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Syt10 G A 15: 89,841,621 T50I probably benign Het
Syt16 T C 12: 74,266,730 Y477H probably damaging Het
Tacr3 A T 3: 134,932,392 T437S probably benign Het
Tg G A 15: 66,683,993 D845N probably benign Het
Uqcc1 G T 2: 155,921,644 S36R possibly damaging Het
Vmn1r20 T C 6: 57,432,406 V239A possibly damaging Het
Xpo7 T A 14: 70,695,663 Q263L possibly damaging Het
Zfp442 T C 2: 150,408,096 K572E probably damaging Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACACTCACACATTCTGGTCAAAG -3'
(R):5'- TTCCAGTAGAGGCAGGGATG -3'

Sequencing Primer
(F):5'- CTCACACATTCTGGTCAAAGTGAGTC -3'
(R):5'- AGGAGAGCACTTTCAGTTCC -3'
Posted On2017-07-14