Incidental Mutation 'R6042:Crybg3'
ID483633
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Namebeta-gamma crystallin domain containing 3
Synonyms
MMRRC Submission 044210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6042 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59490775-59600979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59550475 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 2340 (R2340Q)
Ref Sequence ENSEMBL: ENSMUSP00000156047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000139989] [ENSMUST00000172910]
Predicted Effect probably benign
Transcript: ENSMUST00000044604
AA Change: R626Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723
AA Change: R626Q

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139989
SMART Domains Protein: ENSMUSP00000122663
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
XTALbg 1 86 2.15e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172910
AA Change: R2340Q

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 T A 12: 80,177,249 K478M probably benign Het
Ankar G T 1: 72,674,054 S474* probably null Het
Barx2 C A 9: 31,846,903 E246D probably benign Het
Cdh7 A T 1: 110,138,267 Q757L probably damaging Het
Cnr1 T C 4: 33,944,751 F380L probably damaging Het
Cntnap5b G A 1: 100,390,592 A655T probably benign Het
Col2a1 T A 15: 98,000,570 probably benign Het
Ctsb G T 14: 63,141,856 D306Y probably damaging Het
Cyp2a22 A C 7: 26,934,239 Y349D probably damaging Het
Dcpp2 T C 17: 23,898,912 L22S probably damaging Het
Dnah8 G T 17: 30,747,265 M2476I probably damaging Het
Dst A G 1: 34,188,972 E1882G probably damaging Het
Esrp1 T C 4: 11,357,580 K511E possibly damaging Het
Fat3 T A 9: 16,377,817 T137S probably benign Het
Fbxw24 T A 9: 109,607,011 M318L probably benign Het
Fpr-rs7 T A 17: 20,113,215 T338S probably benign Het
Gcgr T C 11: 120,534,758 M1T probably null Het
Gm13101 G T 4: 143,966,061 D123E probably benign Het
Grifin C A 5: 140,563,556 R135L possibly damaging Het
Helz T C 11: 107,614,120 probably null Het
Hivep3 C G 4: 120,097,864 Q1126E possibly damaging Het
Htr3a T A 9: 48,904,699 H146L probably damaging Het
Lama3 T A 18: 12,574,254 V3081E probably damaging Het
Mgat5 T A 1: 127,459,899 C531S probably damaging Het
Micalcl A G 7: 112,380,412 D106G probably benign Het
Nectin2 C T 7: 19,738,138 A109T probably benign Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr887 T A 9: 38,085,094 V86E probably damaging Het
Olig3 T C 10: 19,356,755 S43P probably damaging Het
Pcdh12 T C 18: 38,281,505 R856G probably damaging Het
Phpt1 T A 2: 25,574,839 M1L probably benign Het
Polr2m T C 9: 71,483,798 I41V probably damaging Het
Pzp A G 6: 128,524,014 V127A possibly damaging Het
Rgs7 G T 1: 175,149,660 T126K probably damaging Het
RP23-399J5.1 T C 8: 71,089,927 noncoding transcript Het
Rras A T 7: 45,020,396 D112V probably damaging Het
Sdcbp2 T A 2: 151,582,726 Y5* probably null Het
Slc43a2 T C 11: 75,570,607 F462L probably damaging Het
Smchd1 T A 17: 71,377,057 K1436* probably null Het
Snrnp27 A C 6: 86,682,920 S31A unknown Het
Sqstm1 A C 11: 50,207,424 F172V probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Syt10 G A 15: 89,841,621 T50I probably benign Het
Syt16 T C 12: 74,266,730 Y477H probably damaging Het
Tacr3 A T 3: 134,932,392 T437S probably benign Het
Tg G A 15: 66,683,993 D845N probably benign Het
Uqcc1 G T 2: 155,921,644 S36R possibly damaging Het
Vmn1r20 T C 6: 57,432,406 V239A possibly damaging Het
Xpo7 T A 14: 70,695,663 Q263L possibly damaging Het
Zfp442 T C 2: 150,408,096 K572E probably damaging Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59529227 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59565211 critical splice donor site probably null
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59544125 missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 unclassified probably null
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59560095 unclassified probably benign
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59559166 missense probably benign 0.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense not run
R7133:Crybg3 UTSW 16 59536804 missense not run
Predicted Primers PCR Primer
(F):5'- TAGCAAATACTTCCTAACCCTGTC -3'
(R):5'- GGGAGATAACCTTCTGTTAAAAGATGC -3'

Sequencing Primer
(F):5'- CTGTCAAGCCACAGCGC -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2017-07-14