Incidental Mutation 'R6043:Mvb12b'
ID483646
Institutional Source Beutler Lab
Gene Symbol Mvb12b
Ensembl Gene ENSMUSG00000038740
Gene Namemultivesicular body subunit 12B
Synonyms
MMRRC Submission 044211-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R6043 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location33729953-33887946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33874390 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 49 (T49K)
Ref Sequence ENSEMBL: ENSMUSP00000048901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041555] [ENSMUST00000148660]
Predicted Effect probably damaging
Transcript: ENSMUST00000041555
AA Change: T49K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048901
Gene: ENSMUSG00000038740
AA Change: T49K

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DUF2464 46 297 1.7e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146892
Predicted Effect probably damaging
Transcript: ENSMUST00000148660
AA Change: T20K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115744
Gene: ENSMUSG00000038740
AA Change: T20K

DomainStartEndE-ValueType
Pfam:DUF2464 17 189 1.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192765
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the ESCRT-I complex, a heterotetramer, which mediates the sorting of ubiquitinated cargo protein from the plasma membrane to the endosomal vesicle. ESCRT-I complex plays an essential role in HIV budding and endosomal protein sorting. Depletion and overexpression of this and related protein (MVB12A) inhibit HIV-1 infectivity and induce unusual viral assembly defects, indicating a role for MVB12 subunits in regulating ESCRT-mediated virus budding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 T C 1: 171,252,601 F44S probably damaging Het
Ap3b1 A T 13: 94,476,993 T667S probably benign Het
BC027072 T C 17: 71,750,042 D880G probably damaging Het
Camsap1 T C 2: 25,929,925 Y1516C probably benign Het
Ccl17 A G 8: 94,810,472 M1V probably null Het
Cfhr1 T A 1: 139,550,868 T255S probably benign Het
Clcn6 T C 4: 148,008,788 N812D probably damaging Het
Cyp2b10 T C 7: 25,917,339 F402L probably damaging Het
Dgkz A C 2: 91,935,889 S776A probably benign Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dnah10 G A 5: 124,801,860 G2728S probably damaging Het
Dnah7b T A 1: 46,139,789 M874K probably benign Het
Eef1akmt3 A T 10: 127,033,278 L109Q probably damaging Het
Egf A G 3: 129,736,785 S243P probably benign Het
Fbxw21 T C 9: 109,145,539 I304M possibly damaging Het
Fcgr4 T C 1: 171,020,130 V99A probably damaging Het
Fhdc1 T C 3: 84,448,886 E417G probably damaging Het
Flnc G T 6: 29,446,608 G939V probably damaging Het
Herc1 A G 9: 66,408,154 M1173V probably benign Het
Hspa2 C T 12: 76,406,322 H597Y probably damaging Het
Itgb4 C T 11: 115,979,386 T64I probably benign Het
Kif16b A G 2: 142,711,900 S993P probably damaging Het
Kitl T A 10: 100,064,085 V84E probably damaging Het
Klra17 A G 6: 129,872,187 probably null Het
Map2k3 A G 11: 60,946,746 D224G probably benign Het
Medag T G 5: 149,422,207 F4V probably benign Het
Mob3b C T 4: 34,985,993 V182I probably benign Het
Naaladl2 A G 3: 24,058,214 V568A possibly damaging Het
Nbea T C 3: 55,786,475 E2174G probably benign Het
Nmd3 T C 3: 69,745,247 Y389H probably benign Het
Olfr1180 C T 2: 88,412,245 E138K probably benign Het
Olfr309 A G 7: 86,306,339 I258T probably damaging Het
Pcdh1 T A 18: 38,203,274 N103Y probably damaging Het
Pcm1 A G 8: 41,328,778 D1905G possibly damaging Het
Plcd1 A G 9: 119,072,599 F619S probably damaging Het
Ptdss1 T A 13: 66,963,369 D166E probably damaging Het
Rnf213 T C 11: 119,442,101 V2713A probably damaging Het
Sema4f T C 6: 82,919,653 N200D probably damaging Het
Tjp1 A T 7: 65,324,089 N472K probably damaging Het
Trav6n-5 T C 14: 53,105,151 Y49H probably benign Het
Trbv2 A G 6: 41,047,970 T107A probably benign Het
Unc13c T C 9: 73,736,651 N1177S possibly damaging Het
Vmn1r212 A G 13: 22,884,088 V25A probably damaging Het
Zfhx4 T G 3: 5,403,427 S2882A probably benign Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Mvb12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Mvb12b APN 2 33827788 missense probably damaging 1.00
IGL02493:Mvb12b APN 2 33840209 missense probably benign 0.05
R1845:Mvb12b UTSW 2 33840157 critical splice donor site probably null
R2225:Mvb12b UTSW 2 33840199 missense possibly damaging 0.88
R4545:Mvb12b UTSW 2 33827700 missense possibly damaging 0.63
R5631:Mvb12b UTSW 2 33827703 missense probably damaging 1.00
R5733:Mvb12b UTSW 2 33827716 missense probably benign 0.02
R6386:Mvb12b UTSW 2 33827742 missense probably damaging 1.00
R6563:Mvb12b UTSW 2 33825116 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGATGTCAAAAGCCTGTGCC -3'
(R):5'- TGTAGAGCTCACTGAGGCTG -3'

Sequencing Primer
(F):5'- AAAGCCTGTGCCAGCCAG -3'
(R):5'- TGGCTGCCCCAGGATTCTC -3'
Posted On2017-07-14