Incidental Mutation 'R6043:Mob3b'
ID483656
Institutional Source Beutler Lab
Gene Symbol Mob3b
Ensembl Gene ENSMUSG00000073910
Gene NameMOB kinase activator 3B
SynonymsA430018A01Rik, MOB3B, 8430436F23Rik, Mobkl2b
MMRRC Submission 044211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6043 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location34949074-35157484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34985993 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 182 (V182I)
Ref Sequence ENSEMBL: ENSMUSP00000100040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102975]
Predicted Effect probably benign
Transcript: ENSMUST00000102975
AA Change: V182I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000100040
Gene: ENSMUSG00000073910
AA Change: V182I

DomainStartEndE-ValueType
Mob1_phocein 33 207 1.93e-105 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. This gene is located on the opposite strand as the interferon kappa precursor (IFNK) gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 T C 1: 171,252,601 F44S probably damaging Het
Ap3b1 A T 13: 94,476,993 T667S probably benign Het
BC027072 T C 17: 71,750,042 D880G probably damaging Het
Camsap1 T C 2: 25,929,925 Y1516C probably benign Het
Ccl17 A G 8: 94,810,472 M1V probably null Het
Cfhr1 T A 1: 139,550,868 T255S probably benign Het
Clcn6 T C 4: 148,008,788 N812D probably damaging Het
Cyp2b10 T C 7: 25,917,339 F402L probably damaging Het
Dgkz A C 2: 91,935,889 S776A probably benign Het
Dnaaf2 A T 12: 69,197,348 L313Q probably damaging Het
Dnah10 G A 5: 124,801,860 G2728S probably damaging Het
Dnah7b T A 1: 46,139,789 M874K probably benign Het
Eef1akmt3 A T 10: 127,033,278 L109Q probably damaging Het
Egf A G 3: 129,736,785 S243P probably benign Het
Fbxw21 T C 9: 109,145,539 I304M possibly damaging Het
Fcgr4 T C 1: 171,020,130 V99A probably damaging Het
Fhdc1 T C 3: 84,448,886 E417G probably damaging Het
Flnc G T 6: 29,446,608 G939V probably damaging Het
Herc1 A G 9: 66,408,154 M1173V probably benign Het
Hspa2 C T 12: 76,406,322 H597Y probably damaging Het
Itgb4 C T 11: 115,979,386 T64I probably benign Het
Kif16b A G 2: 142,711,900 S993P probably damaging Het
Kitl T A 10: 100,064,085 V84E probably damaging Het
Klra17 A G 6: 129,872,187 probably null Het
Map2k3 A G 11: 60,946,746 D224G probably benign Het
Medag T G 5: 149,422,207 F4V probably benign Het
Mvb12b G T 2: 33,874,390 T49K probably damaging Het
Naaladl2 A G 3: 24,058,214 V568A possibly damaging Het
Nbea T C 3: 55,786,475 E2174G probably benign Het
Nmd3 T C 3: 69,745,247 Y389H probably benign Het
Olfr1180 C T 2: 88,412,245 E138K probably benign Het
Olfr309 A G 7: 86,306,339 I258T probably damaging Het
Pcdh1 T A 18: 38,203,274 N103Y probably damaging Het
Pcm1 A G 8: 41,328,778 D1905G possibly damaging Het
Plcd1 A G 9: 119,072,599 F619S probably damaging Het
Ptdss1 T A 13: 66,963,369 D166E probably damaging Het
Rnf213 T C 11: 119,442,101 V2713A probably damaging Het
Sema4f T C 6: 82,919,653 N200D probably damaging Het
Tjp1 A T 7: 65,324,089 N472K probably damaging Het
Trav6n-5 T C 14: 53,105,151 Y49H probably benign Het
Trbv2 A G 6: 41,047,970 T107A probably benign Het
Unc13c T C 9: 73,736,651 N1177S possibly damaging Het
Vmn1r212 A G 13: 22,884,088 V25A probably damaging Het
Zfhx4 T G 3: 5,403,427 S2882A probably benign Het
Zswim5 A C 4: 116,962,621 S408R probably benign Het
Other mutations in Mob3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Mob3b APN 4 35083983 missense probably damaging 1.00
IGL02991:Mob3b UTSW 4 35083805 missense probably benign 0.01
R0016:Mob3b UTSW 4 35083947 missense probably benign 0.02
R0408:Mob3b UTSW 4 35083991 missense probably damaging 1.00
R1542:Mob3b UTSW 4 35084046 missense possibly damaging 0.88
R1686:Mob3b UTSW 4 34985910 splice site probably benign
R1723:Mob3b UTSW 4 34954026 missense probably damaging 0.99
R1726:Mob3b UTSW 4 34954028 missense probably benign 0.09
R2013:Mob3b UTSW 4 35083922 missense probably benign 0.00
R2112:Mob3b UTSW 4 35083795 missense probably damaging 0.97
R5992:Mob3b UTSW 4 35084069 missense probably benign 0.43
R6418:Mob3b UTSW 4 34954049 critical splice acceptor site probably null
R7117:Mob3b UTSW 4 34985914 critical splice donor site probably null
R7170:Mob3b UTSW 4 35083839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACTTATCTGGCTGCAG -3'
(R):5'- CCGTATTCCAGAGGTAAGAGGC -3'

Sequencing Primer
(F):5'- ACACTTATCTGGCTGCAGTGGAC -3'
(R):5'- AGAGGCAAAGCTCCTTCTTAGTG -3'
Posted On2017-07-14