Incidental Mutation 'R6044:Agbl1'
ID483714
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6044 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76318120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 31 (V31A)
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000156166
AA Change: V31A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: V31A

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Adamts20 A T 15: 94,282,483 Y1764N probably damaging Het
Adamtsl1 A T 4: 86,212,691 D223V probably damaging Het
Alk T C 17: 71,992,100 H462R probably benign Het
Amt A T 9: 108,297,251 T72S probably damaging Het
Atp12a T A 14: 56,376,155 D461E probably damaging Het
Bcan C A 3: 87,995,643 C276F probably damaging Het
Crispld2 T C 8: 120,010,671 S54P possibly damaging Het
Cyp11a1 A T 9: 58,026,704 N478I probably damaging Het
Des A T 1: 75,363,469 probably null Het
Dnajc6 A T 4: 101,616,577 I427F probably benign Het
Eml4 T G 17: 83,445,950 L281R probably damaging Het
Fam186a T C 15: 99,941,997 Y2122C probably damaging Het
Fndc11 T A 2: 181,221,666 L88Q probably damaging Het
Foxo1 A G 3: 52,345,837 M474V probably benign Het
Gap43 A T 16: 42,292,187 D70E probably benign Het
Gemin4 T C 11: 76,212,934 M334V probably benign Het
Gm973 T C 1: 59,628,234 L718P probably benign Het
Gprin3 G T 6: 59,353,672 T550N possibly damaging Het
Hddc3 T A 7: 80,343,584 V53E probably benign Het
Itpr2 A T 6: 146,396,951 D12E probably null Het
Kdelc1 A T 1: 44,114,451 L221* probably null Het
Klri2 T A 6: 129,740,284 E45D probably damaging Het
Lct A G 1: 128,307,980 V430A possibly damaging Het
Mcm8 T C 2: 132,831,680 probably null Het
Mmp12 A G 9: 7,350,050 T184A possibly damaging Het
Morc3 T C 16: 93,866,442 V511A probably benign Het
Mta2 T C 19: 8,948,331 Y397H probably damaging Het
Naa50 G A 16: 44,159,527 E93K possibly damaging Het
Olfr113 G A 17: 37,574,535 T296M probably damaging Het
Olfr1250 T A 2: 89,657,172 I90F probably damaging Het
Olfr1261 T C 2: 89,993,417 I8T possibly damaging Het
Olfr1286 T C 2: 111,420,078 N291S probably damaging Het
Olfr1395 T C 11: 49,148,695 V146A probably benign Het
Padi4 A G 4: 140,748,127 S576P possibly damaging Het
Prss47 A T 13: 65,049,306 Y111* probably null Het
Ptprm A G 17: 66,693,862 V1100A probably damaging Het
Rab11fip3 G A 17: 26,067,869 P437S possibly damaging Het
Rsph14 C T 10: 75,031,270 D15N probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco1a1 A G 6: 141,940,017 V94A probably benign Het
Smpdl3a A G 10: 57,811,262 E362G possibly damaging Het
Sva A T 6: 42,040,100 Y47F probably benign Het
Tatdn3 A G 1: 191,056,361 probably null Het
Tmem131 G A 1: 36,881,341 Q93* probably null Het
Tmem136 A G 9: 43,113,608 S18P probably benign Het
Tmem56 A T 3: 121,207,369 I205K probably damaging Het
Trpm7 T C 2: 126,814,745 E1184G probably damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Usp40 A T 1: 87,990,150 I325K probably benign Het
Vmn2r27 T G 6: 124,231,772 I5L probably benign Het
Wee1 C T 7: 110,139,306 T542I probably benign Het
Wrn G A 8: 33,236,429 P1129S probably damaging Het
Zfyve16 G A 13: 92,522,666 Q246* probably null Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACTTCACAGACTTGATCTCAGC -3'
(R):5'- GTGACAAGGCCGAATAGACC -3'

Sequencing Primer
(F):5'- TTCACAGACTTGATCTCAGCTCAAC -3'
(R):5'- GCTTTATCAAGTTACACCAAGGGG -3'
Posted On2017-07-14